How do I know the orientation of my insert in a plasmid after sequencing? (View forum version)



bioguy

Posted 18 April 2013 - 09:21 AM

Hi,

I just received the results of the sequencing of several plasmids I received from other lab. I ran a PCR with M13F and M13R and sequenced them with M13F or M13R. Now I need to know the orientation of the insert and which enzymes I need to use to make RNA probes. How can I get this information? Below is one of my sequences. Thank you very much.

>PCR-M13R (supposed to be Danio rerio collagen, type I, alpha 2)
GMYGCATACCCTCACTAAAGGGAACAAAAGCTGGAGCTCGCGCGCCTGCAGGTCGACACTAGTGGATCCAAAGAATTCGG
CACGAGGCAAGAACTGGTACAGAAGCTCCCAGGAGAAGAAACACACCTGGTTTGGCGAGACTATCAACAGTGGTACTGAG
TTTGCTTACAATGACGAGACCCTGAGCCCACAATCCATGGCTACTCAGCTGGCCTTCATGCGTCTACTGGCCAACCAGGC
AGTCCAGAACATCACCTACCACTGCAAGAACAGCATCGCCTACATGGATGCTGAGAATGGAAACCTGAAGAAGGCTGTGT
TGCTGCAGGGTTCCAATGATGTTGAGCTCAGGGCGGAGGGCAACAGCCGCTTCACTTTCAGCGTCCTAGAGGATGGCTGC
AGTAGACACACTGGCCAGTGGAGCAAGACAGTCATTGAATACAGAACAAATAAACCATCTCGCCTTCCCATCCTCGACAT
TGCACCTTTGGACATTGGTGGCGCAGATCAAGAGTTTGGTTTGGACATTGGCCCAGTCTGTTTCAAATAAATAGACTCAT
GATAAATTAAACGAGAGAAAGAAAGAAAAAAGAAAAATCTCTGCCCTTCTTTCTGTGTTTTTTTATACTGAATGCTGATT
TTTTTCCGCAAATCCACTTGCTTAAGCTGGGCTCTATCGGAGTGGACCAATGGACTGAACGGAGCATTGCGCAATGCAAA
TTAATACAGCAGCCCAAAGAGACGCGGGAGGGATAACACCATGTTATGGGACATGTCATCATTTTGTAAAAATTAAAGAA
GTGTAATAAAAAGAATGAAAGTATACATCACTTTGTGGTCTTTGTATATCTTCCAAAGAGGAAGTTTAAAACCACAATTT
CCGTAAGGTTTAAACTACCTCATGTGTAAAGGAAAATAATAATCAACATCCTAGTCGTCGCTAGATGGTACTAACGCTTC
AAGTTCTGTCCTGTTTCAAAGTGCTCCAATACTTGAAGCAGTGATATTATATGGTGCTAAACATGCAGCTGTGGAGAAAA
CCACTGTACTGTATACTTTGTATGTCTCTACGATATGGCACAGTCCCCTGATATCCATTTTAGCAGTGATATCCTAACTG
AAKGTATGTYCKGGCTTTGACCTTTGGCT

pcrman

Posted 18 April 2013 - 10:32 AM

If you have already sequenced your plasmid using M13F and R primers, the resulted sequence should tell the orientation of the insert because you know the location of the primers in the vector and which primer gives you which sequence.

bioguy

Posted 18 April 2013 - 11:42 PM

Yeah, but some I sequenced with M13F and some with M13R, so now what EXACTLY should I do to check the orientation? Should I blast the sequences and see if the alignment with the blast hits returns a plus/plus strand? Then, does that mean that I have the sense sequence? What about the polymerase? I found SP6 in some of my sequences, but it was the reverse complement of SP6. What does that mean?