Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!

Penguin's Content

There have been 15 items by Penguin (Search limited from 20-November 18)


Sort by                Order  

#109592 Fixation of virus for TEM

Posted by Penguin on 12 May 2011 - 07:50 AM in Microbiology

Oh, sorry -- I saw you wanted to fix the samples -- Fixation in formaldehyde or glutaraldehyde can make at least minor structural changes. In either case, shorter fixation is better. If that is acceptable, it may be easier to inactivate the virus without fixing, as noted above.


Hi David!
Thanks, I think I will try 2.5% glut for a range of times, 10-60 minutes probably, then check my virus is dead, then take the samples to the EM to see if structure is affected,
P



#109443 Fixation of virus for TEM

Posted by Penguin on 11 May 2011 - 02:27 AM in Microbiology

Hi!

Does anyone have any experience of fixing virus samples before negative staining for transmission electron microscopy? I work with a pathogenic virus that has to be fully killed before I can take it out of the lab. Usually I would does this by heat inactivation but this causes alterations in the virus particle so clearly this is not possible for EM studies. I think formaldehyde is also too harsh so I think I need to use glutaraldehyde. Any suggestions on concentration, time and temp of incubation? I need to fully inactivate the virus but maintain structure!

Thanks,
P



#104022 Why does T7 RNA transcription start with a GGG?

Posted by Penguin on 18 March 2011 - 03:09 AM in Molecular Biology

Hi again!

Nice paper, it makes sense to me that the preceding TATA allows easier melting of DNA template and the initiating GGG stabilises the transcriptional unit through base-pairing with the template CCC.

Think I can pull off a coherent response if asked about this in my viva now!

Thanks,
P



#104019 Why does T7 RNA transcription start with a GGG?

Posted by Penguin on 18 March 2011 - 01:59 AM in Molecular Biology

Hi,

I just quickly looked at the sequence of pET3a and the T7 transcription start site does begin with a GGG. pET3a T7 promoter = TTAATACGACTCACTATAGGG, with the GGG being the first 3 nucleotides transcribed (obviously this is not the translation start site which would begin at ATG). As far as I am aware this identical T7 promoter is present in all expression vectors.

P



#103937 Why does T7 RNA transcription start with a GGG?

Posted by Penguin on 17 March 2011 - 04:17 AM in Molecular Biology

Hi guys!

I'm doing some revision for my PhD viva next month and am delving in to stuff I'd never thought of (but probably should have!!) before.

My question is why does transcription from a T7 promoter initiate with a GGG? Looking at various papers I think it helps with specificity as G-C pairs melt less readily i.e. T7 binds upstream of the GGG then promotes melting of the 3 G-C base pairs???

Any thoughts? Does anyone know of a great review that has looked at this?

Thanks!
P



#98162 Apparent kDs

Posted by Penguin on 20 January 2011 - 11:26 PM in Biochemistry

Thanks guys,

I think my main source of confusion stems from the fact that most publications use the term KD when in reality the term apparent KD should be used. I guess its standard to do this and most journals don't worry about it.

The reason I'm asking is because I'm writing my thesis and I always use the term apparent KD. I wanted to be sure this was correct before I have to explain to an examiner why my calculations are only apparent.

Thanks again!
P



#97996 Apparent kDs

Posted by Penguin on 19 January 2011 - 01:34 PM in Biochemistry

The terms are super confusing and interchangeable. Biacore has a lot of really good application/technical notes that really go into binding kinetics - that may be a good resource for information. Dissociation rates can be measured directly when using SPR-like technologies.


Hi,
I've spoken to some SPR experts and they say that, although SPR gives good estimates, it can still only provide apparent binding affinities and the only technique which gives actual KDs is Isothermal Titration Calorimetry (ITC). But I still don't know what is really meant by apparent KD and how it's different from KD - any ideas??

Thanks,
P



#97912 Apparent kDs

Posted by Penguin on 19 January 2011 - 05:03 AM in Biochemistry

Hi,

I have recently been told I cannot refer to KD values calculated through binding assays withour calling them apparent KDs (or KDapp). I think this is because a standard binding assay only measures association rates and not disassociation rates. Can anyone confirm this? I've been googling for half an hour now and I can't find any good explanations for the use of the term apparent!

Thanks
P



#97233 HACAT cells

Posted by Penguin on 12 January 2011 - 12:24 AM in Cell Biology

Hi,

No sorry, I only ever used them as a control cell line to test the off-target effects of the compounds I made, so I don't really know anything specifically about HaCaT characteristics

P



#97180 HACAT cells

Posted by Penguin on 11 January 2011 - 09:15 AM in Cell Biology

Hi,
Sorry I have never worked with HaCaT in transwell but your protocol looks good to me. I don't think you need to worry about being too harsh with the cells as they usually stick very hard to substrate - do they stick well to your membrane? Can you do your washing steps in the transwells so that you don't break the membrane i.e. fill the wells with PBS/water/alcohol then aspirate the liquid off??

P



#97139 HACAT cells

Posted by Penguin on 11 January 2011 - 04:16 AM in Cell Biology

Hi,
I would like to seed and grow HaCaT cells to form monolayer. How long time does it take to them to be confluent? Does anybody have experiences with this issue?


Hi,

It all depends on how many you seed to start with, of course the more cells you put in the faster they'll get to confluency, but also HaCaT cells do not like being at low density. They take longer to double if you seed at 10% then if you seed at 50%. I usually seed 2 X 105 in a 9.5 cm2 plate and by the next day they are at 60% confluent.

P



#97072 Circular Dichroism and disordered proteins

Posted by Penguin on 10 January 2011 - 08:23 AM in Protein and Proteomics

Hi,

I have never done any CD and only have a vague idea of how it works, but in my PhD thesis (which is due in at the end of the month!!!!) I mention that the protein I work with is intrinsically disordered, some of the evidence being a CD minimum at 200 nm. I've tried searching for explanations for why a minimum at 200 nm means disorder but find that most guides to CD are inpenetrable for non-experts!! I assume that unfolded polypeptides don't absorb well at 200 nm but why??

If I am asked about this in my viva I'm not sure what to say - any ideas??

Thanks,
P



#93144 How does Mfold work??

Posted by Penguin on 25 November 2010 - 04:11 AM in Biochemistry

Hi all!

I have used Mfold to predict structures for some RNA molecules. The info on the Mfold website says that it uses energy-minimising algorithms to calculate possible RNA structures. So does this mean that only the most energetically favorable structures are plotted i.e. pair up G-C first? The output also gives deltaG values - so is this the amount of energy released upon the RNA folding?? What is more energetically favorable, a higher negative number e.g. deltaG = -13.6 or a lower negative number e.g. deltaG = -7.4??

Thanks!
P



#70836 MTT assay

Posted by Penguin on 13 May 2010 - 10:09 PM in Cell Biology

Oh ok, I guess cell debris and serum etc.

Thanks bob1!



#70732 MTT assay

Posted by Penguin on 13 May 2010 - 10:36 AM in Cell Biology

Hey!

Does anyone know why all the MTT assay protocols tell you to subtract the background at 630 nm when you take the readings at 570 nm???

Thanks,
P




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.