Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!

hanming86's Content

There have been 44 items by hanming86 (Search limited from 22-October 18)



Sort by                Order  

#83043 NCBI BlastN issue

Posted by hanming86 on 10 August 2010 - 06:27 PM in Molecular Biology

Hi,

I started a topic yesterday in Bioinfo regarding NCBI blastN, i would like you all to be aware that when blasting against bacterial genome.. you will no longer get the Gene ID/ Genebank associated with the subject sequence that your query is most related to. No more associated gene.. this definitely makes life harder.

It still works for BlastP. For those involved in bacterial genetic and novel gene isolation .. i think our lives have just been rendered slightly difficult. You still could get somewhat info on the gene by turning on the " CDS feature" it will help out abit. In order to download the FASTA sequence, we have to open up the entire genome of the bacteria and key in the region that we would like to get info on instead of clicking on the "linkout" provided last time.


Let me know if any of you are experiencing the similar situation.



#83042 Blast Nucleotide Issue

Posted by hanming86 on 10 August 2010 - 06:19 PM in Bioinformatics and Biostatistics

you are totally right ...a week ago or so there was a clear link to the gene associated with the hit sequence!

This feature is now missing ...and it was a very important feature to my point of view!!!

I think i should also contact the NCBI support to stress that this feature has to be reactivated!

Regards,
p


I did email the NCBI people, after discussing with the developers he said i could turn on "CDS feature" in the formatting option .. but i know it used to be way EASIER!

I wonder why they remove this particularly useful feature. it definitely saves more time.

Let me know what the NCBI people tell you. They usually reply pretty quickly. I was directed to a person called Dr Tao Tao.



#82969 Blast Nucleotide Issue

Posted by hanming86 on 10 August 2010 - 09:56 AM in Bioinformatics and Biostatistics

Recently, whenever i compare bacteria DNA sequence against the blast nucleotide. using " others (nr/nt) " database, i can no longer obtain the " linkout" or the annotated gene ( gene ID) that supposedly come together with the comparison.

IN the end , i have to open the whole genome.. and take out the genome region that i wan according the the number(BOLDED) from the alignment and find the gene ID/CDS from there.

Query 35 TCGGCCCCGGCACGCCCGGCGGCAATCTGCTGCGTCGTTACTGGCAGCCCGTGGCCCTGG 94
||||||| ||||| ||| |||| | ||| |||| | || ||||| || ||||| ||||
Sbjct 2225376 TCGGCCCGGGCACTCCCTGCGGGCAGCTGATGCGCCAGTATTGGCAACCGGTGGCGCTGG 2225317

The NCBI staff insists that i am wrong. but i know it existed because i been doing alot of blast work before this.

IN this picture that i m uploading.. there's NO darkblue box with G to indicate genebank in the links area.

It's all empty. It used to be there when i did it last month.. and i had the " linkout" box ticked.

Attached Thumbnails

  • ScreenHunter_01 Aug. 11 01.53.gif



#77071 Plasmid DNA mini-prep

Posted by hanming86 on 25 June 2010 - 09:09 PM in Molecular Cloning

Try this.

Make new solution of Ammonium acetate.

After one month this solution goes cuckcoo apparently due to decomposition.

My plasmid prep " resist' digestion after one month from the preparation of my solutions.

b4 that everything was ok.

changing the solution 3 made all the difference.



#74340 Freezing PCR product???

Posted by hanming86 on 07 June 2010 - 08:52 PM in Molecular Biology

-20 storage for PCR product shouldn't be a problem for restriction digest.

As for sequencing. i believe 1-2 months are OK.

once i sent a 1 year old product out for sequencing.. that's pretty much a mess



#65137 No enzyme Activity (dioxygenase assay)

Posted by hanming86 on 01 April 2010 - 07:51 PM in Protein and Proteomics

did you run a gel of your preparation? did it show a band or pattern that you expect for your protein?

you could have a denatured enzyme. you may also be experiencing the presence of a native inhibitor. the enzyme may be too dilute in the extract.

you may have to at least partially purify the enzyme.


According to the literature this sort of dioxygenase system is a multicomponent one. IN any case, from what i have read most group could observe activity when they did the enzyme assay with cell-free extract but using other sort of aromatic compound.

As of now, i do not know whether which enzyme is specific for its reaction. The fact that it could grow on the compound as its sole nitrogen /carbon source should indicate it has the pathway for this degradation. so in my mind, the enzyme(s) should be present.

Currently hoping to develop/modify an existing assay first to determine its activity prior to partial purification.

Thanks for the comment.

i have added glycerol and dtt. i wonder if you have any suggestion as to how to stabilize and prevent its denaturation.

In addition, how to prevent the effect of native inhibitor? that's somewhat new to me



#65052 No enzyme Activity (dioxygenase assay)

Posted by hanming86 on 01 April 2010 - 12:56 AM in Protein and Proteomics

Hi guys,

I am assaying for a dioxygenase activity on a aromatic compound , basically a aromatic ring hydroxylating activity.

The cell was grown using the aromatic compound as sole carbon source .

during the mid log phase, i harvested the cell . centrifuged at 4000rpm at 4C for 30 min.

washed with 20mM K/Na Phostphate buffer once

then eventually the cell was resuspended in 50mM Tris-HCL pH 7.5 with 1mM DTT and 10% Glycerol

in order to extract the protein , i used a Vibracell 600W. 10% amplitude 2.5pulse and 2.5 pause. for 10 min. done in ice bath

The lysate is clear. then i proceed to centrifuge at 12,000rpm for 30 min.

The supernatant would be the cell-free extract in my stage.


So from here the reaction goes like this


1ml reaction (containing)

0.4mM NADH
0.2mM Ferrous ammonium sulfate
25mM Tris-HCL pH7.5
0.05 ml Cell Free extract
1mM of aromatic compound


incubate at 30C for 30 min

negative control is the similar reaction but without the substrate.


i compared the abs at 340nm for reduction in NADH.

at the end , i couldn't observe any significant difference.


What could be the problem.

any suggestion would be highly appreciated

1. extracellular enzyme??
2. denatured protein?
3. any other??

it's my first time experience in doing enzyme assay . hope to hear from you guys soon.



#64503 Ferrous sulfate

Posted by hanming86 on 28 March 2010 - 02:03 AM in General Lab Techniques

It has oxidized into Fe3+. no point using, solubility is severely affected.

to prevent this by acidifying the solution with sulphuric acid to pH 2 or less.

or use ammonium ferrous sulphate. the Ammonium keep the solution acidic to some extent



#63421 Sequence, question!

Posted by hanming86 on 20 March 2010 - 09:19 PM in Molecular Biology

Considering it's from cancel cell then .. i wouldn't think of it as weird. when u work with mammalian cell .. i think they have differing number of chromosome. allele? it could have just been that it's a combined pcr product from different allele or so.

go with the AT cloning business adn get the individual plasmid as suggested above.



#63420 Nde1-BamH1 makes me sad

Posted by hanming86 on 20 March 2010 - 09:10 PM in Molecular Biology

Try NdeI and XhoI if you could. works well. with promega both can work in Buffer D. essentially it should save you alot of work. and the efficiency is very nice too.



#61197 Lysis buffer

Posted by hanming86 on 04 March 2010 - 08:25 AM in General Lab Techniques

But why should life be simple and without challenges :(

Thank you all for your comments, finally after a week in + 70 C my buffer seems to be clear!


I also suspect it is EDTA. A week in 70C.. crazy haha.
however if at all time u could keep it simple, please do. Research is a race against time.



#61195 Good tool for sequence validation?

Posted by hanming86 on 04 March 2010 - 08:22 AM in Molecular Cloning

I use sequencher 4.8

it gives restriction site, codon map etc, easy to align. demo version but i still like it.

also 4 years of great experience with it.

my first ever sequencing software and still one of my favorite



#61194 Huge difference in Tm of my For and Rev primers = no PCR product?!?

Posted by hanming86 on 04 March 2010 - 08:18 AM in Molecular Cloning

1.with that high of a GC content on the forward, i believe it is possible to achieve higher Tm value.
2. Instead of messing with the Tm value, have you tried using DMSO from 2-8%??
3. and try longer denaturation time.



#61193 problem in plasmid isolation

Posted by hanming86 on 04 March 2010 - 08:14 AM in Molecular Cloning

1. check ur plasmid kit.
2. use higher antibiotic concentration.
3. the m13 primer could be non specific binding
4. kinda unlikely - recombination event ?



#61192 Ethanol in PCR clean-up

Posted by hanming86 on 04 March 2010 - 08:11 AM in Molecular Biology

just make sure the ethanol is at least 95% pure.

i have seen Industrial based ethanol (Cheap stufff) that we would use for flaming or the typical 70% etoh disinfectant being used for DNA-based work.

urg needless to say inconsistent sequencing result, bad digest etc etc.

it will smell different. pure ethanol won't sting the nose as compared to cheap one



#60483 To clean or not to clean.....?

Posted by hanming86 on 25 February 2010 - 07:30 PM in Molecular Cloning

i would however recommend a purification step first.

This is to avoid having a suboptimal condition for the restriction digest. the salt present in the pcr reaction might affect the final salt concentration required for various restriction enzyme which eventually cause star activity or decrease or even inhibits the reaction.



#57137 Tris solution yellow?!

Posted by hanming86 on 30 January 2010 - 03:59 AM in General Lab Techniques

Hey guys ,

i have been looking through the tris powder in my lab. particularly those from a particular manufacturer. it appears that the tris powder itself is somewhat yellowish.

an undergrad student make a 50X tae buffer with it and holy smoke, the whole buffer is yellowish...

should that be a concern?

is there any explaination to why the tris powder is yellowish. as far as i am concerned it should be white.



#57136 ta cloning of pfu amplified fragment

Posted by hanming86 on 30 January 2010 - 03:57 AM in Molecular Cloning

Continue to amplify with your proof reading polymerase. You should purify the product before adding the A overhangs as the pfu will remove them unless you go immediately onto the cloning step.


thanks for reply but how come in long pcr or high fidelity enzyme mixes that are mixture of tag and a proofreading enzyme we can use pcr product directly in t/a cloning? isnt there a risk of a overhang removal?



Well, in long PCR mix, the amount of proof reading polymerase is present in quite small amount. even if it removes it , the dominant Taq will add it back and there might be those without tail but perhaps at very minute amount.



#53768 Ligation and Transformation help needed: pENTR1A Vector issue

Posted by hanming86 on 03 January 2010 - 07:08 PM in Molecular Cloning

Gel extraction typically causes quite a lot of downstream problems. I would recommend doing an ethanol precipitation on the eluted sample to rid of any remaining agarose or other inhibitor.

However in your case, i think you might be able to eliminate gel extraction if i m analyzing ur information right. i did make an assumption that the distance between NotI and SaiI cutsite is quite small <50bp perhaps.

Using this assumption here..

What i would do.

AFter u PCR out the gene using primer which will give another more bases before the SaiI site


1. digest vector/ pcr fragment separately
2. NotI and SaiI could be run in the same buffer, both are heat inactivatable, that's good.
3. after digestion, heat inactivate, ethanol precipitation
4. ligation
5. transform

regards,

Ming



#53455 DNA precipitation

Posted by hanming86 on 30 December 2009 - 08:39 PM in Molecular Biology

the idea I came through is that amm.acet is anionic, and so it pulls apart the DNA strands (by disturbing hydrogen bonds between bases). this when combined with low temperature and propanol/ethnaol (non-polar solvents) forces the DNA to precipitate.
with regard to potassium acetate in plasmid extraction, its said that it makes the cell-lysis-solution a little less alkaline (how??) so that this pH is sufficient for the small plasmid DNA to reanneal and not the big genomic DNA.
and finally amm.acet for protein extraction, its said that it decreases the dielectric constant of water, thereby disturbing the hydration layer of proteins, forcing them to precipitate (with addition of isopropanol). I'm not quite sure whats the relation between dielectric constant and hydration layer


potassium acetate pH5.5 usually. it neutralize the solution and renature the nucleic acid which was previously denatured by NaOH. however, genomic DNA will have trouble reannealing properly as they are huge.. eventually they precipitate out of the solution. while plasmid DNA is small and will anneal well and remain in the solution.



#53454 Identifying PCR Inhibitors

Posted by hanming86 on 30 December 2009 - 08:37 PM in Molecular Biology

In addition, if u haven't tried, there's this qiagen stool kit with the inclusion of something like a pellet that act as a PCR inhibitor absorber. this probably might help abit against the sample you're encountering.

combine that with omni taq and u might just get what you need.



#53452 Question about Plasmid Isolation Protocol containing Phenol/Chloroform PEG

Posted by hanming86 on 30 December 2009 - 08:33 PM in Molecular Biology

Thanks for your help! it worked quiet well!!
Do you know if the final plasmid is clean enough for sequencing and transformation?
if not what should i do to obtain clean quality?



For transformation, definitely . sequencing i would assume it's alright. washing with 70% ethanol usually will provide sufficiently clean DNA. way better than conventional column purification.



#41764 BL21A or simliar

Posted by hanming86 on 29 October 2009 - 07:44 PM in Protein Expression and Purification

buy it or get it from some ppl working in molecular lab close to you.
BL21 (DE3) is a pretty common strain especially if the lab is working on protein expression.



#41667 Looking for a not-so-good paper

Posted by hanming86 on 29 October 2009 - 03:57 AM in Dissertation and Paper Writing

low impact journal



#40522 New approach to H1N1 "pandemic"- recalibration

Posted by hanming86 on 20 October 2009 - 06:44 PM in Microbiology

Nice one george. Good read. strong argument. sometimes, i think this flu is being overrated. in malaysia, most death are usually caused not primarily by H1n1 but some other disease that was present before.




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.