Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!

bob1's Content

There have been 138 items by bob1 (Search limited from 22-July 18)



Sort by                Order  

#181911 Cloning protein of interest into lentiviral vector - help - I have no experience

Posted by bob1 on 17 July 2019 - 08:02 AM in Molecular Cloning

1)Yes, the ATG is part of the Kozac sequence. You actually have a minimal Kozac sequence there, the full one is (GCC) GCC RCC ATG (G) the last G helps but is actually not entirely necessary either, though it is highly conserved, along with the R. 

 

2) No, they don't need to be in multiples of 3, this is only necessary after the start codon so that they encode the correct amino acids. Having said that, with the use of recombination via the attB sites, there are special considerations with respect to frame, but I'm not sure exactly on those. So long as you copied correctly from the manual, there shouldn't be a problem.

 

3) You have done the correct thing and used the sequence from your plasmid. This will ensure that your primers are specific for your sequence and will work at the correct melting temperature. Don't worry about the bases I used - I copied those from somewhere else, not from your plasmid sequence. There is some wiggle room in terms of exactly which bases encode the various amino-acids in the HA tag, so different sequences can encode the same amino-acid sequence. To complicate things even more, there are different HAs for different species, so a mouse HA is different to a human HA. Use the one from the plasmid that you have!

 

The tag sequence you have given translates to YPYDVPDY, and it looks like you have copied the ATG, the GGC and the first 24 of the HA correctly from the plasmid as analyzed by Addgene, and annotated by the depositor. If you search for this sequence you will come up with it being the epitope for anti-HA antibodies. The sequence you have used for the Kozak is correct, and your start site is in-frame with your HA tag, so I am sure that you have the correct sequence and it will work.




#181909 Cloning protein of interest into lentiviral vector - help - I have no experience

Posted by bob1 on 16 July 2019 - 05:55 AM in Molecular Cloning

Those look fine to me. You probably don't strictly need the Shine-Delgarno sequence in the forward primer, but it won't hurt to keep it in there. If you copied the sequences from the manual, they should be absolutely fine. I can't see the extra base that you mention, all the bases there are ones that are in the manual, or are for the HA tag. The reverse primer looks good too.

 

The 24 bases will most likely work. You probably don't need quite that many to do the PCR, but so long as the annealing temperature of this section is below about 72 C, then it should work. This also applies to the reverse primer.

 

Make sure that you read the rest of the manual and follow the instructions, particularly those about the E. coli strains to use. In general I recommend getting the basic kit to start with, like the ones that are mentioned on the front page of the manual you attached. However, I see that both of these are discontinued, and I don't know what replaced them. Get in touch with their technical support service - they are good at what they do, they actually have proper science nerds (like myself, though I don't work for them) manning the support system, so they should be able to help.




#181907 Cloning protein of interest into lentiviral vector - help - I have no experience

Posted by bob1 on 14 July 2019 - 07:02 PM in Molecular Cloning

1) EcoRI and NotI would work just fine. The insert was cloned into the vector you have using NotI, so that should be fine. EcoRI looks like it is outside the HA, so that should work too. NotI shouldn't be any harder to use than most of the other ones. If you used EcoRI and NotI it will be best to do the two restrictions in separate reactions as the most efficient buffers are different for both. Note that this means you need to use a lot of DNA for each digestion step as you will need to purify after each digestion. I'd recommend starting with 2-4 ug, and having about 1 ug in your final digestion.
 
Note that when you do your ligation you should work out the molar ratios of the insert to vector - you do this from the relative lengths. There's a calculator here to make it easy. 1:1 molar ratios often work, but not always, so you may need to try a few different ones.
 
2) I don't know much about the lentiviral vectors, but I think that you need to start with an entry vector and use the Att1 sites for recombination into a destination vector. I think this is means that you don't need restriction enzymes apart from to get into the entry vector. I've never used this system so I can't advise much more than that.  EcoNI is different to EcoRI.
 
3) Detailed protocols would be difficult to write out here, and are covered well at this site.

 

However, some pointers and a general outline will be helpful. Assuming you have some purified plasmid to start with.

 

 

  1) Restriction digestion of plasmid to get linearized empty vector with incompatible ends

  • You need your plasmid DNA, the restriction enzyme and its corresponding buffer.
  • Set up 50 ul reactions using a 4-fold excess of enzyme (i.e. if you have 1 ug plasmid, use 4 U of enzyme). Gel purification used in later steps only has about 10% return; digest a lot of DNA, but I wouldn't go above about 5 ug/reaction.
  • Incubate at recommended restriction temperature (often 37 C, but not always) for the recommended time (usually 1 h). Do not over digest.
  • Run the digested plasmid on a gel and cut out the digested band - you need to run undigested plasmid and ladder to compare, Hopefully you will see a single bright band of the right size. Gel purify this band. 
  • Repeat digestion step with other enzyme. Purify this one with a regular DNA extraction, you most likely won't see any difference to the previous step if run on a gel. You can however assess if this digestion is likely to have worked by digesting uncut vector and seeing if it has linearized. 
  • I do not recommend using a phosphatase to prevent vector self-ligation, they are hard to remove and interfere with subsequent steps. Most protocols you will find generate incompatible overhanging ends and do not strictly need dephosphorylation.

  2) Digestion of vector with insert to extract insert.

  • This is just like above, so repeat the first 3 steps 
  • Repeat step 4, but instead cut out and gel purify the insert - this will be a shorter band - determine the correct size and compare to a DNA ladder. 

  3) Ligation. Note the troubleshooting steps here

  • Don't use more than 100 ng per reaction.
  • Work out the molar ratios and test several
  • Overhang ligations, like you will probably do, work well in less than 1 h usually. 
  • Always always always run a control that contains digested vector only - if you see a lot of colonies (more than about 50, compared to 200+ for vector and insert ligation) from transforming this, your digestion of your vector has not worked well at the second step and you will need to repeat it or screen a higher number of colonies.

  4) Transformation. 

  • you've probably done this before. If you haven't let me know and I can give more pointers.



#181905 Cloning protein of interest into lentiviral vector - help - I have no experience

Posted by bob1 on 13 July 2019 - 07:30 PM in Molecular Cloning

OK, that's a pretty comprehensive plasmid map, most are simpler. From it I can see that you actually have two tags on your protein - HA and Glutathione S transferase (GST), these are both N-terminal (i.e. appear before the start of your gene of interest), and that the HA is before the GST. The MCS in this case has been split into at least two parts - there will be a parent plasmid with it as one contiguous region, but yours  starts with BbsI (position 1688 from the ori), and ends with BamHI (3996), the insert is between these two positions and is the reason the MCS is split. The HA and GST were already in these plasmids as you can see from the cloning information, which states that the insert was cloned using SalI and NotI.

 

I can also see, by comparing the restriction sites between this vector and pcDNA3.1(+), that you have some that are compatible, but these are in a different order in the two plasmids. This would result in your insert going in backwards, so you can't do a common subcloning into that vector. So, your best option is to amplify the insert using PCR and add the desired restriction sites and make it easy for yourself.

 

The HA can be either on the plasmid when you clone in, or it can be part of the insert. If you want your gene as it is with both tags, simply get the sequence from Addgene, look for the open-reading frame (ORF) that encodes your gene of interest and design primers based on that. The gene specific sequence will be the first and last 20ish bp of your insert. Take a look at the plasmid you want to clone into - look at the MCS and choose two restriction sites. I recommend sticking with two of the more easy ones, something like EcoRI and BamHI works well for pcDNA3.1.  If you are using pcDNA3.1 and those sites; EcoRI will go on the forward primer and BamHI on the reverse so that the insert will be oriented correctly when you come to express it. Now you simply do a PCR, digest insert and target, then ligate. Note that EcoRI and BamHI work well in Phusion PCR buffer, though the HF versions do not. See here for more information on the enzymes and their activity in PCR buffer.

 

If you do not want the GST tag (I wouldn't, tags can interfere with folding of the proteins...). You can add the HA tag (see here for sequence) to either the forward or reverse primers, depending on whether you want a N- or C-terminal tag. Note that if you want it N-terminal, you need to add an ATG start site before the tag sequence, so the primer would look like this:

NNNNNN GGATCC NNNNNN ATG TACCCATACGATGTTCCAGATTACGCT NNNNNN YOUR_DNA_SEQUENCE

6bp    BamH1 spacer start HA tag                   spacer your_DNA...

Spacer after tag must be multiples of 3 to keep sequence in-frame.  Conversely if you wanted a c-terminal tag you would need to add a stop codon. The annealing temperature of the primers does not include the non-sequence specific stuff like the tag, just work it out off your DNA sequence. 

 

There's a lot more to it than that - go to your local university library and find the book "Molecular cloning: a laboratory manual" by Sambrook et al., there is a lot of excellent information in there.




#181903 Cloning protein of interest into lentiviral vector - help - I have no experience

Posted by bob1 on 13 July 2019 - 06:03 AM in Molecular Cloning

1) no you don't need flp-in or viruses to make stable cell lines, you can also use things like CRISPR, or even (with the right vector) have a selection process, just like you do for bacteria, that allows maintenance of the plasmid within the cell. This requires the right sort of plasmid that can be copied by the cell, there are lots of different ones around. Check out Addgene.org for a good repository of plasmids. There's a good basic summary here. A common vector used for this is the pcDNA3 series from Life Technologies.

 

2) see above

 

3)I don't know about lentiviral vectors, but the cloning process is the same. Basically what you need to do is look at the sequence for the vector+insert you have right now and determine if it can be subcloned into the lentiviral vector you choose. To do this you look for common restriction sites (you may need to learn about isoschizomers) within the multiple cloning site (MCS), its the region with lots of restriction sites within maybe 100 bp of each-other. If you can find ones that suit for the correct orientation of your insert, then you can use those to digest out your insert, digest the target plasmid and then ligate the insert and target together.

 

If you can't find common ones - fear not. It is easy to generate the sites you want with PCR - design primers for your insert that have a 5' tail consisting of 6 random bases, your RE site, then a spacer (3-6bp usually) and then your insert sequence. It'll look something like this (the GGTACC is the sequence for Kpn1 restriction, substitute your desired RE sequence):

 

NNNNNNGGTACCNNNNNfirst_or_last_20_bp_of_your_insert

 

You then amplify by PCR (use a high fidelity enzyme with proof-reading), digest the insert and target plasmid with the desired enzyme(s), ligate. You can also use this method to add a tag or anything else you want - just don't forget to change the ATG position and keep the insert in-frame.

 

If you are really stuck - and have plenty of money floating around, there are a couple of other options - you can get genes made for you by a number of companies, and most of those will insert it into your vector of choice if you supply the vector and pay a bit more. Or you can investigate TA cloning, specifically Topo-TA kits. TA cloning is where you just amplify which-ever insert you want using Taq polymerase, it adds an A overhang on the ends of sequences, then you use this to ligate into the vector. The Topo-TA kits make this very simple by adding a ligase to the cloning site that will do it all for you. You just have to check the insert orientation once cloned.




#181875 ebv igm borderline

Posted by bob1 on 14 June 2019 - 04:03 PM in Microbiology

This is a test for the presence of IgM antibodies in your blood as a result of a recent infection with Epstein-Barr virus (also known as infectious mononucleosis, kissing disease, glandular fever). If these antibodies are found in your blood you have signs of a recent infection or a re-activation of an old infection.

 

The virus is one of the very wide-spread Herpesvirus family and is very infectious. Most people when infected with the virus show symptoms similar to a cold and then develop life-long immunity to the virus, but the virus can and does reside in the body, just like other Herpes viruses do (cold-sores - this is why they can re-develop under stress, it is the virus residing in the body), and like other herpes viruses can reactivate, but it only does this rarely. A few of the people infected will develop glandular fever and become more typically sick with protracted  fever, lethargy and fatigue among other symptoms.

 

The tests measure how much of the antibody you have in your blood and there is a level at which you are defined as definitely having had the virus present. The tests have some error in them as a result of non-specific reactions (i.e. they measure IgM from other infections to some extent too). Now, the result is a range designed to encompass most of the cases of infection. Sometimes people present with a borderline result - this means that the test has measured some antibody, but the amount is too near the limits of the test to say anything definite about you having had the infection. They may ask for a follow-up test where they look at a different type of antibody called IgG which would indicate an infection that happened a while ago and is the "long lasting" body response that allows the body to identify infections that you have had in the past and fight those off more effectively. This is the sort of antibody that vaccinations aim to increase.




#181858 NGS vs third-generation sequencing

Posted by bob1 on 30 May 2019 - 06:10 AM in General Biology Discussion

You have basically understood the difference - Illumina (2nd generation) and the like provide many many short reads - the maximum they can do is about 300 bp, after this the error rate increases. They are basically massively parallel Sanger sequencing - each base added on sens out a fluorescent signal that is interpreted by the machine based on the color of the signal. There is much more complexity to it than that, but it's an analogy that sort of works. 

 

3rd gen sequencing is based off a two different technologies, which can be divided into pore based (Oxford Nanopore) and zero-mode waveguide (PacBio). The pore based technologies work around changes in electrical current with the pore expanding and shrinking as each base is fed through the pore by a molecular motor. PacBio uses a tiny well called a zero-mode waveguide (ZMW) with a polymerase attached at the bottom.  The ZMW is a small area that is constrained in size such that you can observe a single nucleotide at a time in the volume. To do this the polymerase attaches a fluorescent tagged nucleotide to the strand of DNA being synthesized and this is read by fluorescence, as the next base gets attached, the previous one gets shunted out of the ZMW and is no longer observable.




#181844 conditioned medium

Posted by bob1 on 21 May 2019 - 06:57 PM in Tissue and Cell Culture

You pretty much have it correct. I would recommend filtering the medium through a 0.1 um filter too, just in case there is some contamination associated with the feeder cells.

 

You can dilute, but it is not absolutely necessary in my experience, and will depend on what exactly you are doing with the cells.




#181840 Do you have references to study the Cellular Biology of Kidney?

Posted by bob1 on 16 May 2019 - 06:43 AM in -Cell Biology-

What sort of understanding level do you have already? While not comprehensive, the wikipedia page might be a good place to start. Do you need anatomy as well as physiology?




#181832 What is going on with these cells?

Posted by bob1 on 10 May 2019 - 06:07 AM in Tissue and Cell Culture

The ATCC recommends only FBS (15%) in their culture conditions, perhaps try leaving out the 2-ME, at least for one passage, and see if that helps. You can return it later if needed.

 

The confluency issue could be a plating one - if you plate at too low a density, then some cells will not proliferate - this is more often a problem with neuronal type cells. I don't know about pancreatic cells.

 

If the cells are alive and floating, it may be that they will re-attach if you leave them for a day or so longer.

 

Another issue might be that some component of your medium is not what it seems - DMEM expires after a while, so if you don't have a fresh bottle (less than 1 month open) it would pay to get some fresh. If you are preparing the medium from powder, the water quality is of extremely high concern - it must be ultrapure (e.g. MilliQ), and you must ensure that all the contents of the packet are added to the medium - rinse the packet with the water during prep until no more color comes out (assuming phenol red is in your medium). Also if you are preparing your own medium, the bottles have to be very very clean - any detergent residue will affect the cells. 




#181827 What is going on with these cells?

Posted by bob1 on 08 May 2019 - 08:33 AM in Tissue and Cell Culture

If you tell us exactly what you are doing - culture conditions, FBS%, how you thaw (removal of DMSO? etc), are you passaging in the state that we see in the first photo or waiting until more confluent? These sorts of things will help diagnose the problem.

 

Have you taken an aliquot of the floating cells and looked to see if they are dead, or just floating?

 

The first image looks like very low density, have you tried seeding at a higher density?




#181825 question about the sample size

Posted by bob1 on 07 May 2019 - 05:53 PM in Bioinformatics and Biostatistics

To do any sort of statistics to assess the diversity from each host, you would need to have several samples from each host species and assess the diversity from each sample. This would allow you to have a mean number of species and perform statistical tests. Generally you would need a sample size of 30 samples or more for parametric tests (e.g. student's t-test, ANOVA), though you can get away with fewer with some loss of power.




#181820 Dilution buffer

Posted by bob1 on 01 May 2019 - 06:14 AM in General Lab Techniques

Because the salt concentrations are so similar  - 40 mM and 50 mM, mixing them at a 1:1 ratio will give you a final concentration of 45 mM NaCl. This would mean adding 200 ul of buffer B mix to the 200 ul of protein already dissolved in buffer A.




#181813 Where to publish paper on seed dormancy?

Posted by bob1 on 28 April 2019 - 07:32 AM in Journal Discussion - How to Get Papers Published

If you are wanting to pursue a career in science, you will need to start reading papers - this is the only way to become familiar with what has happened in your field and what is currently happening. I would suggest starting with a reading a recent review on your topic, these are often the most accessible way of getting into the literature, as they summarize what is known about a (subset of) your field. Just be aware that usually the reviews are trying to sell a particular view point or are just something that (often a student) has written to get themselves familiar with the field, and so may not be complete in covering all the literature.

 

From your post it looks like you have two avenues - either you aim to publish in a botanical/plant biology journal or you aim for a ethno-botanical journal. I would think that general plant biology is probably more widely read and so more likely to boost your publishing indices (e.g. H factor) and name recognition. 

 

Just do a google search for "plant journals" (or "ethnobotany journals") and see what comes up. You can also try searches such as "plant journal and seed dormance" - have a look at the content in a couple of the journals and see if you and your supervisor think they publish research similar to what you have done, and so might be willing to publish your research, and then try to write the paper in they same style as the papers within and submit it. All journals have submission guidelines for the author somewhere on the journal's website.




#181796 Question regarding picture

Posted by bob1 on 17 April 2019 - 11:32 AM in General Lab Techniques

I would say stereo microscope with camera attachment. I think you would need a dark-field or possibly DIC (how this would work with agar is another question...) set-up to get this to work clearly, but it may be that just plain transmitted light would work. 

 

I suspect that they grew the colonies on thin agar layers on slides or something similar to help the light transmission through the agar.




#181789 why schools need to be fully equipped with science lab equipment?

Posted by bob1 on 12 April 2019 - 06:22 AM in Lab Equipments

What sort of equipment do you need? There are a large number of suppliers of scientific equipment around. The common ones are Sigma-Aldrich, Thermo-Fisher and Millipore but there are many others too.




#181787 Neisseria grown in MacConkey

Posted by bob1 on 10 April 2019 - 07:14 AM in Microbiology

The ATCC and other culture collections have varying methods of growing this species. ATCC recommends using brain-heart infusion agar/broth, while others recommend Columbia blood medium and Medium 72 for trypto casein soy agar. I did see one paper mention McConkey, and another that used blood or chocolate agars (presumably based on tryptic soy agar). It looks like most people grow them in 5% CO2 as well.

 

I think most Neisseria species are fastidious, so unless you have the right components in your agar you won't get them to grow. From the recommended agars I would guess that this is the case for N. zoodegmatis too - they probably need some blood and/or specific nutrients.




#181777 quantity IHC images

Posted by bob1 on 31 March 2019 - 06:48 PM in Molecular Biology

Depends on what exactly you want to do, but for most applications there is a version of ImageJ that comes pre-packaged with a lot of image analysis tools: FIJI (Fiji is just imageJ)




#181773 Where can I find lists of challenges in life sciences and medicine?

Posted by bob1 on 29 March 2019 - 08:37 AM in General Biology Discussion

Here's some good ones: 

 

A cure for cancer

 

Understanding the immune system

 

Antibiotic resistance

 

Emerging infectious diseases




#181772 How do determine the reference gene for SMN 2

Posted by bob1 on 29 March 2019 - 08:22 AM in PCR, RT-PCR and Real-Time PCR

It will depend a little bit on the species you are looking for but generally you can find this information on the National Center for Biotechnology Information (NCBI) website, which is part of the National Institutes of Health in the USA. They are generally considered to be the repository that stores the genome information for many many species. Most human mRNA references are indicated by an alphanumeric code that looks like "NM_#####.#", where # is a sequence of digits. For genomic sequences you will find the same format but with "NG_" at the start. Proteins are "NP_"

 

For instance, with a brief google search I found this for the human SMN2 gene, which led me to this page from the NCBI, where if you scroll down you will find a section entitled "NCBI Reference Sequences (RefSeq)" under which you will find the appropriate reference sequences for the genomic sequence, the various isoforms of mRNA and their associated proteins, as well as the information for the annotated genome assembly (note this may be different to the genomic reference, as assembly builds are whole genome), along with tons of other information.

 

 




#181760 Semipermeable membranes

Posted by bob1 on 18 March 2019 - 06:01 PM in General Lab Techniques

Dialysis membranes are what you are looking for.




#181754 Semipermeable membranes

Posted by bob1 on 15 March 2019 - 06:37 AM in General Lab Techniques

Google the terms you are unsure of - think a little. Size exclusion - might mean what in terms of proteins?

 

 

 

try Millipore.com




#181753 Biofilm

Posted by bob1 on 15 March 2019 - 06:34 AM in General Lab Techniques

What is biofilm?

2 seconds worth of googling will tell you that.




#181741 How can I find all the endothermic reactions with a specific substrate?

Posted by bob1 on 14 March 2019 - 05:46 AM in Biochemistry

You could try pubchem, it aims to do this sort of thing.




#181738 How can I find all the endothermic reactions with a specific substrate?

Posted by bob1 on 13 March 2019 - 07:19 PM in Biochemistry

You can't - we don't know that information as we don't know the full functions of every protein and process in the cell. This is assuming you are talking biological reactions. Even for chemical reactions you could only make assumptions about classes of compounds for a limited number of types of compounds.





Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.