Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!

bob1's Content

There have been 121 items by bob1 (Search limited from 21-November 18)



Sort by                Order  

#182057 spike-in control

Posted by bob1 on 09 November 2019 - 12:53 AM in siRNA, microRNA and RNAi

A spike-in control is when you add a known amount of a known target to a reaction. You use this when you need to check that your reactions are working as expected and your data is the result of correct amplification of your target genes. You wouldn't normally use it as a standard for quantitation other than you can use it to create a standard curve for copy-number determination.



#182048 Are there any machine learning tool/text mining tool to analyse text ?

Posted by bob1 on 24 October 2019 - 03:51 PM in Bioinformatics and Biostatistics

What format is your text in? If it is in strings, you should be able to use a regular expression (regex) such as 

\d+

where the "\d" stands for digit and the "+" indicates one or more.




#181999 RNA concentration weight and molarity

Posted by bob1 on 13 September 2019 - 02:24 PM in General Lab Techniques

That would be about correct. I haven't done the concentration calculations, but the concept is correct.

 

As to the comparison, it depends on what you want to do, but if you are looking at expression of a gene, that would probably work OK.




#181995 RNA concentration weight and molarity

Posted by bob1 on 12 September 2019 - 07:11 PM in General Lab Techniques

You are correct - RNAs (or DNAs) of different lengths have different concentrations for the same mass. This is because the concentration is dependent on the number of molecules per volume, not the mass per volume. If you have 1 molecule of 10 nucleotide length, its molecular mass will be half that of one of 20 nucleotides. For the same mass dissolved in the same volume, the shorter one will have a higher molarity because it takes more molecules to make up the same mass.

 

You can't determine the concentration exactly because any population of RNA or DNA is likely to contain some longer and some shorter molecules, and you would need to take these into account in your calculations... which you can't do because you don't know the exact amount of them. However, what you can do is determine the average length and then use that to calculate a concentration from average molecular mass based on the length.




#181991 Cloning protein of interest into lentiviral vector - help - I have no experience

Posted by bob1 on 10 September 2019 - 08:07 AM in Molecular Cloning

What OldCloner meant was that there are sites on the plasmid - on either side of your insert - that are the sites that the gateway cloning system uses to get from one plasmid to another. These are usually designated AttR or AttB or something similar. If these sites are mutated, the gateway system will not work, so he was saying that you should confirm these sequences are correct too.

 

Primers are primers - the ones you use in real-time/qPCR are no different to those for regular PCR. If you are using a Taqman system then there are also the probes which are different and not the same as primers in that they insert between the primer sites. Basically however, they all boil down to the same thing - an oligonucleotide sequence that binds DNA. There are no special considerations for sequencing, just do the regular annealing temp/GC content things. You don't need these in pairs - only one primer per reaction for seqencing, as I am sure you already know. 




#181987 Running Novex type precasts on BioRad Mini Protean

Posted by bob1 on 09 September 2019 - 03:35 AM in SDS-PAGE and Western Blotting

I don't know if this is any help but the Hoeffer systems used to be compatible with the Invitrogen systems including Novex.

 

I don't think you can make the two compatible - the Bio-rad gels are shorter, so I think you could possibly run those on an Invitrogen system, but not the other way around.




#181982 Human homologs, orthologs, and paralogs for bacterial topoisomerases

Posted by bob1 on 06 September 2019 - 04:12 PM in -Genetics and Epigenetics-

You are in the wrong place @Danfosvltsrew (Jo)... this is a biomedical forum, not a software source.




#181981 Labelling cryovials etc for crystorage

Posted by bob1 on 06 September 2019 - 04:11 PM in Lab Equipments

No devices but I have had good experience with Tough Tags. You can make up a template from the specifications, which means you print on the sheet and then stick on by hand.




#181980 double bands on p-p70s6k WB

Posted by bob1 on 06 September 2019 - 04:09 PM in SDS-PAGE and Western Blotting

What were your conditions for blotting and antibody detection, and what steps have you tried to eliminate non-specific bands? What does the literature, including the product website say about this antibody?

 

If you are using this antibody: https://www.cellsign...1-antibody/9208 Note the sizes mentioned...




#181978 Cloning protein of interest into lentiviral vector - help - I have no experience

Posted by bob1 on 05 September 2019 - 03:00 PM in Molecular Cloning

Congratulations, it sounds like you have successfully got your cloning to work. 

 

The best way is to ensure that you have coverage from one end of your insert to another. This allows you to see if there were any errors in the sequence that might affect the open reading frame.

 

To do this, design some primers that are spaced about every 300-400 bases apart on the sequence. This should ensure that you cover the entire sequence with adequate overlap to rule out sequencing errors.  If you note a particular error in your sequence, design a reverse primer about 100 bp away from that site so that you can check if it is just a sequencing error or not. 

 

By the way - Check out Snapgene viewer for a good, free plasmid viewer. It is capable of taking sequences and doing all the plasmid mapping based on automated detection of sequence features etc. The full version is not free and comes with some really nice features that would be handy, but the free one covers most applications.




#181973 Riska factor analyses

Posted by bob1 on 03 September 2019 - 06:32 PM in Bioinformatics and Biostatistics

I'm no expert, but my understanding was the PCA gave you values of percentage contribution of each variable, which you can then express as a plot if you want to. I don't know whether it can do combinations of the variables or not.




#181971 Riska factor analyses

Posted by bob1 on 03 September 2019 - 08:29 AM in Bioinformatics and Biostatistics

What about a principal component analysis?




#181970 Oligo Molarity

Posted by bob1 on 03 September 2019 - 08:28 AM in Molecular Biology

I think you may be confused here. To me it looks like you have a Qiagen system for capturing mRNA and cDNA synthesis via an immobilized oligo-dT. If this is the case, then they have supplied it at the concentration needed for the kit, and you need to use the capture plates/strip-tubes to use this effectively. It is not designed to make cDNA in an independent reaction (though it probably could).

 

They have not supplied enough information to calculate the molarity of the solution.

 

To determine the molarity you would need to know how long an oligomer you have. Most likely this is between 12 and 22 bases long, and is probably a mixture of lengths, though they may have HPLC or gel purified it to get it into a conjugated form for the immobilization. From this you could work out the molecular mass for each and then use that to determine the concentration in uM.

 

However, you probably don't need to do this - most reactions for cDNA synthesis use around 0.5 ug of oligo-dT per ug of polyA-mRNA or 0.5 ug with less than 5 ug of total RNA.




#181967 10% SDS Adjusting pH???

Posted by bob1 on 01 September 2019 - 11:13 AM in SDS-PAGE and Western Blotting

@PatruhinKW - this is a biomedical forum regarding laboratory techniques - you most likely won't find the answer here. In our world SDS is a chemical a bit like soap that is used for dissolving proteins.

 

I think you should look further afield for your answers. Possibly on egosoft.com




#181964 shRNAs work in vitro, not in vivo

Posted by bob1 on 28 August 2019 - 04:28 PM in siRNA, microRNA and RNAi

@GamzinGQ, this is a biomedical science forum, not computing, perhaps try stackexchange.com.




#181962 0.2 M Sodium Acetate Buffer

Posted by bob1 on 27 August 2019 - 06:37 AM in General Lab Techniques

Ah - in that case, while they are incorrect about the concentration, they are correct about the use!

 

It's been a while, but I think last time I used TMB in an acetate system, that the concentration of the acetate was around 0.1 mol/l, though I see that the original paper used 0.2 mol/l. If the system is working in the lab as-is, I wouldn't change it, even if they are mistaken in their nomenclature (other than to get them to change how they refer to the buffer perhaps). This is the sort of information that gets lost when you move on to another lab and someone tries to repeat your experiments, only to find that because you were using proper 0.2 mol/l and they used 0.07 mol/l that the results are different!




#181961 Semipermeable membranes

Posted by bob1 on 27 August 2019 - 05:28 AM in General Lab Techniques

What's the application? To concentrate the solute or to get pure water out?




#181958 0.2 M Sodium Acetate Buffer

Posted by bob1 on 27 August 2019 - 04:20 AM in General Lab Techniques

The people in your lab are wrong - if you take a 0.2 mol/l solution and then dilute it with water, you always end up with a less concentrated solution.

 

The paper you linked has this to say, right above the acetate buffers section:

 

 

The accuracy of the following tables is within ±0.05 pH at 23°C. The molarity of the buffer described is between 0.05 M and 0.1 M

  Note the bolded part...

 

If you want an easy buffer calculator try here: https://www.cusabio.com/m-296.html#a01




#181956 Semipermeable membranes

Posted by bob1 on 26 August 2019 - 05:39 AM in General Lab Techniques

It is passing through - by osmosis - from high concentration to low concentration. It's just that it is coming out in molecular form and evaporating. The holes are too small for water to squirt/drip out of, but I bet if they left that membrane to sit it would dry out eventually.




#181954 Semipermeable membranes

Posted by bob1 on 25 August 2019 - 08:23 PM in General Lab Techniques

None - they work on osmosis.




#181911 Cloning protein of interest into lentiviral vector - help - I have no experience

Posted by bob1 on 17 July 2019 - 08:02 AM in Molecular Cloning

1)Yes, the ATG is part of the Kozac sequence. You actually have a minimal Kozac sequence there, the full one is (GCC) GCC RCC ATG (G) the last G helps but is actually not entirely necessary either, though it is highly conserved, along with the R. 

 

2) No, they don't need to be in multiples of 3, this is only necessary after the start codon so that they encode the correct amino acids. Having said that, with the use of recombination via the attB sites, there are special considerations with respect to frame, but I'm not sure exactly on those. So long as you copied correctly from the manual, there shouldn't be a problem.

 

3) You have done the correct thing and used the sequence from your plasmid. This will ensure that your primers are specific for your sequence and will work at the correct melting temperature. Don't worry about the bases I used - I copied those from somewhere else, not from your plasmid sequence. There is some wiggle room in terms of exactly which bases encode the various amino-acids in the HA tag, so different sequences can encode the same amino-acid sequence. To complicate things even more, there are different HAs for different species, so a mouse HA is different to a human HA. Use the one from the plasmid that you have!

 

The tag sequence you have given translates to YPYDVPDY, and it looks like you have copied the ATG, the GGC and the first 24 of the HA correctly from the plasmid as analyzed by Addgene, and annotated by the depositor. If you search for this sequence you will come up with it being the epitope for anti-HA antibodies. The sequence you have used for the Kozak is correct, and your start site is in-frame with your HA tag, so I am sure that you have the correct sequence and it will work.




#181909 Cloning protein of interest into lentiviral vector - help - I have no experience

Posted by bob1 on 16 July 2019 - 05:55 AM in Molecular Cloning

Those look fine to me. You probably don't strictly need the Shine-Delgarno sequence in the forward primer, but it won't hurt to keep it in there. If you copied the sequences from the manual, they should be absolutely fine. I can't see the extra base that you mention, all the bases there are ones that are in the manual, or are for the HA tag. The reverse primer looks good too.

 

The 24 bases will most likely work. You probably don't need quite that many to do the PCR, but so long as the annealing temperature of this section is below about 72 C, then it should work. This also applies to the reverse primer.

 

Make sure that you read the rest of the manual and follow the instructions, particularly those about the E. coli strains to use. In general I recommend getting the basic kit to start with, like the ones that are mentioned on the front page of the manual you attached. However, I see that both of these are discontinued, and I don't know what replaced them. Get in touch with their technical support service - they are good at what they do, they actually have proper science nerds (like myself, though I don't work for them) manning the support system, so they should be able to help.




#181907 Cloning protein of interest into lentiviral vector - help - I have no experience

Posted by bob1 on 14 July 2019 - 07:02 PM in Molecular Cloning

1) EcoRI and NotI would work just fine. The insert was cloned into the vector you have using NotI, so that should be fine. EcoRI looks like it is outside the HA, so that should work too. NotI shouldn't be any harder to use than most of the other ones. If you used EcoRI and NotI it will be best to do the two restrictions in separate reactions as the most efficient buffers are different for both. Note that this means you need to use a lot of DNA for each digestion step as you will need to purify after each digestion. I'd recommend starting with 2-4 ug, and having about 1 ug in your final digestion.
 
Note that when you do your ligation you should work out the molar ratios of the insert to vector - you do this from the relative lengths. There's a calculator here to make it easy. 1:1 molar ratios often work, but not always, so you may need to try a few different ones.
 
2) I don't know much about the lentiviral vectors, but I think that you need to start with an entry vector and use the Att1 sites for recombination into a destination vector. I think this is means that you don't need restriction enzymes apart from to get into the entry vector. I've never used this system so I can't advise much more than that.  EcoNI is different to EcoRI.
 
3) Detailed protocols would be difficult to write out here, and are covered well at this site.

 

However, some pointers and a general outline will be helpful. Assuming you have some purified plasmid to start with.

 

 

  1) Restriction digestion of plasmid to get linearized empty vector with incompatible ends

  • You need your plasmid DNA, the restriction enzyme and its corresponding buffer.
  • Set up 50 ul reactions using a 4-fold excess of enzyme (i.e. if you have 1 ug plasmid, use 4 U of enzyme). Gel purification used in later steps only has about 10% return; digest a lot of DNA, but I wouldn't go above about 5 ug/reaction.
  • Incubate at recommended restriction temperature (often 37 C, but not always) for the recommended time (usually 1 h). Do not over digest.
  • Run the digested plasmid on a gel and cut out the digested band - you need to run undigested plasmid and ladder to compare, Hopefully you will see a single bright band of the right size. Gel purify this band. 
  • Repeat digestion step with other enzyme. Purify this one with a regular DNA extraction, you most likely won't see any difference to the previous step if run on a gel. You can however assess if this digestion is likely to have worked by digesting uncut vector and seeing if it has linearized. 
  • I do not recommend using a phosphatase to prevent vector self-ligation, they are hard to remove and interfere with subsequent steps. Most protocols you will find generate incompatible overhanging ends and do not strictly need dephosphorylation.

  2) Digestion of vector with insert to extract insert.

  • This is just like above, so repeat the first 3 steps 
  • Repeat step 4, but instead cut out and gel purify the insert - this will be a shorter band - determine the correct size and compare to a DNA ladder. 

  3) Ligation. Note the troubleshooting steps here

  • Don't use more than 100 ng per reaction.
  • Work out the molar ratios and test several
  • Overhang ligations, like you will probably do, work well in less than 1 h usually. 
  • Always always always run a control that contains digested vector only - if you see a lot of colonies (more than about 50, compared to 200+ for vector and insert ligation) from transforming this, your digestion of your vector has not worked well at the second step and you will need to repeat it or screen a higher number of colonies.

  4) Transformation. 

  • you've probably done this before. If you haven't let me know and I can give more pointers.



#181905 Cloning protein of interest into lentiviral vector - help - I have no experience

Posted by bob1 on 13 July 2019 - 07:30 PM in Molecular Cloning

OK, that's a pretty comprehensive plasmid map, most are simpler. From it I can see that you actually have two tags on your protein - HA and Glutathione S transferase (GST), these are both N-terminal (i.e. appear before the start of your gene of interest), and that the HA is before the GST. The MCS in this case has been split into at least two parts - there will be a parent plasmid with it as one contiguous region, but yours  starts with BbsI (position 1688 from the ori), and ends with BamHI (3996), the insert is between these two positions and is the reason the MCS is split. The HA and GST were already in these plasmids as you can see from the cloning information, which states that the insert was cloned using SalI and NotI.

 

I can also see, by comparing the restriction sites between this vector and pcDNA3.1(+), that you have some that are compatible, but these are in a different order in the two plasmids. This would result in your insert going in backwards, so you can't do a common subcloning into that vector. So, your best option is to amplify the insert using PCR and add the desired restriction sites and make it easy for yourself.

 

The HA can be either on the plasmid when you clone in, or it can be part of the insert. If you want your gene as it is with both tags, simply get the sequence from Addgene, look for the open-reading frame (ORF) that encodes your gene of interest and design primers based on that. The gene specific sequence will be the first and last 20ish bp of your insert. Take a look at the plasmid you want to clone into - look at the MCS and choose two restriction sites. I recommend sticking with two of the more easy ones, something like EcoRI and BamHI works well for pcDNA3.1.  If you are using pcDNA3.1 and those sites; EcoRI will go on the forward primer and BamHI on the reverse so that the insert will be oriented correctly when you come to express it. Now you simply do a PCR, digest insert and target, then ligate. Note that EcoRI and BamHI work well in Phusion PCR buffer, though the HF versions do not. See here for more information on the enzymes and their activity in PCR buffer.

 

If you do not want the GST tag (I wouldn't, tags can interfere with folding of the proteins...). You can add the HA tag (see here for sequence) to either the forward or reverse primers, depending on whether you want a N- or C-terminal tag. Note that if you want it N-terminal, you need to add an ATG start site before the tag sequence, so the primer would look like this:

NNNNNN GGATCC NNNNNN ATG TACCCATACGATGTTCCAGATTACGCT NNNNNN YOUR_DNA_SEQUENCE

6bp    BamH1 spacer start HA tag                   spacer your_DNA...

Spacer after tag must be multiples of 3 to keep sequence in-frame.  Conversely if you wanted a c-terminal tag you would need to add a stop codon. The annealing temperature of the primers does not include the non-sequence specific stuff like the tag, just work it out off your DNA sequence. 

 

There's a lot more to it than that - go to your local university library and find the book "Molecular cloning: a laboratory manual" by Sambrook et al., there is a lot of excellent information in there.




#181903 Cloning protein of interest into lentiviral vector - help - I have no experience

Posted by bob1 on 13 July 2019 - 06:03 AM in Molecular Cloning

1) no you don't need flp-in or viruses to make stable cell lines, you can also use things like CRISPR, or even (with the right vector) have a selection process, just like you do for bacteria, that allows maintenance of the plasmid within the cell. This requires the right sort of plasmid that can be copied by the cell, there are lots of different ones around. Check out Addgene.org for a good repository of plasmids. There's a good basic summary here. A common vector used for this is the pcDNA3 series from Life Technologies.

 

2) see above

 

3)I don't know about lentiviral vectors, but the cloning process is the same. Basically what you need to do is look at the sequence for the vector+insert you have right now and determine if it can be subcloned into the lentiviral vector you choose. To do this you look for common restriction sites (you may need to learn about isoschizomers) within the multiple cloning site (MCS), its the region with lots of restriction sites within maybe 100 bp of each-other. If you can find ones that suit for the correct orientation of your insert, then you can use those to digest out your insert, digest the target plasmid and then ligate the insert and target together.

 

If you can't find common ones - fear not. It is easy to generate the sites you want with PCR - design primers for your insert that have a 5' tail consisting of 6 random bases, your RE site, then a spacer (3-6bp usually) and then your insert sequence. It'll look something like this (the GGTACC is the sequence for Kpn1 restriction, substitute your desired RE sequence):

 

NNNNNNGGTACCNNNNNfirst_or_last_20_bp_of_your_insert

 

You then amplify by PCR (use a high fidelity enzyme with proof-reading), digest the insert and target plasmid with the desired enzyme(s), ligate. You can also use this method to add a tag or anything else you want - just don't forget to change the ATG position and keep the insert in-frame.

 

If you are really stuck - and have plenty of money floating around, there are a couple of other options - you can get genes made for you by a number of companies, and most of those will insert it into your vector of choice if you supply the vector and pay a bit more. Or you can investigate TA cloning, specifically Topo-TA kits. TA cloning is where you just amplify which-ever insert you want using Taq polymerase, it adds an A overhang on the ends of sequences, then you use this to ligate into the vector. The Topo-TA kits make this very simple by adding a ligase to the cloning site that will do it all for you. You just have to check the insert orientation once cloned.





Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.