Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!

yossi.b's Content

There have been 11 items by yossi.b (Search limited from 23-January 19)


Sort by                Order  

#4607 Southern blotting

Posted by yossi.b on 24 October 2003 - 02:50 AM in Molecular Biology

u need to do 2 things:

1. take any DNA marker u want, i use the dna ladder from biolabs and run it in your southern gel.

2. while u marked your probe do another probe from bluescript vector and use it in your southern. because there is similarity between the bluescript vector and the marker (they make the marker from bacteria dna) u will get stained marker. of course if u do soutern for bacteria it will not work. it is easy way to mark a dna ladder and without extra cost.

good luck yossi



#4342 northern problem

Posted by yossi.b on 28 June 2003 - 06:19 AM in Molecular Biology

hi i meant that whole the filter was dark i think i know why. my probe containing a bluescript sequence and i think that it is hybridize some how with the salmon sperm. when i cut the bluescript part of my probe the filter was much less dark.
if u have more suggestions i will glad to hear about them



#4336 Southern set-up

Posted by yossi.b on 25 June 2003 - 09:09 AM in Molecular Biology

do u know the all dna sequence? if u do so choose enzyme that cut at your gene limits (if your gene is more then 15 kp so cut just part of him). (know what is the size of this fragment) use probe that is more then 500 bp from your gene do your probe by pcr or cut and insert it to a vector. the rest of the protocol u can find on this site.
good luck yossi



#4324 PCR and Primers

Posted by yossi.b on 19 June 2003 - 11:58 PM in Molecular Biology

hi in unix there is a gcg program with the command of foldrna "file name"
the program check if the primer can fold on it self. check this before ordering a new primers the delta g need to be -1 and more. below -1 the primer has good chance to fold on it self
good luck yossi



#4323 42bp fragment ligation to 4776bp vector

Posted by yossi.b on 19 June 2003 - 11:44 PM in Molecular Biology

after annealing the oligo will look like below where is the snabi restriction site ? even the
BAmHi site is not completly. u must have the two restriction sites in the insert when u cut the vecgor with this two enzymes.

5' ATAAGTAATTTTCTTTTCGTAACAAATTAAAAAATATAAATG 3'
3' TATTCATTAAAAGAAAAGCATTGTTTAATTTTTTATATTTACCTAG 5'

SnaBI TAC'GTA BamHI G'GATC_C

please clarify your question and i promise full attention to your problem

good luck yossi u can write to my e-mail too.



#4266 star activity about BamH I and EcoR I

Posted by yossi.b on 29 May 2003 - 11:35 PM in Molecular Biology

hi
i did it once they have star activity but with special condition u can do it.
like u know 1 unit of enzyme cut 1 ug dna in one hour for dicrease star activity use less enzyme and less incubaton time do it in big volume (100 ul).

if it still with star activity write to my e-mail yossibuganim@yahoo.com
good luck yossi



#4184 northern problem

Posted by yossi.b on 01 May 2003 - 10:45 PM in Molecular Biology

hi everyone
i tried to do northern, my problem is when i exposed the filter(nytran) to the film i got dark picture. i assume that the prob binded unspecificlly but i used salmon sperm, i baked the filter in uv 3 min. each side and i washed the filter 5 times with different concentration of sds and ssc.
any more suggestion why the prob can bind unspecificlly to the filter?
thank is advence



#4132 AMPLIFYING LONG FRAGMENTS

Posted by yossi.b on 10 April 2003 - 11:59 PM in Molecular Biology

hi fmuylle

your unspecific bands are probably due to unspecific annealling -increase your tm.
if u can please write your PCR cycles program.
for 3 Kb fragment u need at least 2.5 min alongation every cycle- try to increase it too

good luck



#4122 In reference to low tm

Posted by yossi.b on 07 April 2003 - 10:25 AM in Molecular Biology

hi seaner below are the reasons for PCR smearing
1. check your primer TM.(while smearing - increase).
2. over loading sample.(load less dna).
3. put the reaction tube with out the Taq in 95oC for 1 min and then add the taq and continue the PCR reaction. this step do not allow the taq to work while the temperature is increasing to 95oC for the first cycle.( it is importent just to the first step).
4. RNA contamination in your mini prep - the band is amplified but u can not see it because of the RNA - use RNAse.
5. less importent but try to load the sample with out the PCR oil.
6. check your primer if they anneal with other places in the vector.
7. i'm sorry to mantiaed this but check your PCR program again be sure all the steps are o.k.
8. it is very importent while smearing to use very low amount of the templae (try ng, pico gr , and even ato gr).
9. the most importent step is to kiss the tube before the reaction.
good luck yossi



#4116 RNA contamination PCR

Posted by yossi.b on 04 April 2003 - 12:01 AM in Molecular Biology

first of all u can add RNAse A 10mg/ml (3 ul for 100 ul solution). second RNA contamination do not disturbe the PCR reaction at all. u need dsDNA to amplified the gene u want. if u can see the desired band u can use gel purification kit to isolate the band and then do PCR while the purified band will be now the template.
p.s. be sure that what u see is RNA and not nonspesific bands (look like a smir) as a result of low TM condition.
good luck

yossi



#4106 RNA isolation

Posted by yossi.b on 28 March 2003 - 12:55 AM in Molecular Biology

hellow everybody

i am trying to isolate RNA from a single drosophila embryo for RT PCR.
I have the DNA isolation protocol but i don't know how to isolate the RNA.

it is very importent to me so ....

thank




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.