Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!

jerryshelly1's Content

There have been 197 items by jerryshelly1 (Search limited from 10-August 19)



Sort by                Order  

#166398 293t transfected with prtTA inducible vex

Posted by jerryshelly1 on 28 March 2014 - 09:23 AM in Molecular Biology

What lentiviral vector are you using? Have you consulted the vector literature to see if your problem is included in the troubleshooting section?

 

Explain how GFP is not inducible.

 

Edit - I just reread my post and it sounds confusing. Yes, you confirmed your insert was present in your vector via sequencing and propagated that plasmid. You transfected this purified plasmid in your 293T cells, so there should only be your GFP tagged construct. I am confused to how you are going to sort out your cells. The presence of the GFP will indicate that your GFP tagged construct is 'leaking." This could easily be confirmed via western blot to show that you have one band, indicating your tagged protein.




#166400 293t transfected with prtTA inducible vex

Posted by jerryshelly1 on 28 March 2014 - 10:50 AM in Molecular Biology

Sounds good. Can I get a vector name to satisfy my curiosity?




#166396 293t transfected with prtTA inducible vex

Posted by jerryshelly1 on 28 March 2014 - 08:30 AM in Molecular Biology

Yes it sounds like you have basal expression of your GFP in the absence of Tet. This is not entirely uncommon. Maybe you should consider using a different Tet system to avoid abberant expression of your vector.




#163575 A question about Antibodies.

Posted by jerryshelly1 on 19 December 2013 - 07:59 AM in -Immunology and Neuroscience-

They only produce antibodies when they are activated, but they can remain activated for some time. The production of antibodies is geared toward a specific type of pathogen. Antibodies recognize pathogens via a particular epitope that is present on the pathogen. It is possible that an antibody can recognize different pathogens as long as they both carry the epitope that the antibody recognizes.

 

 

Maybe use the below link as a refreseher:

http://www.ncbi.nlm....books/NBK26884/

 

Decent animation showing antibody recognition:

http://highered.mcgr..._epitopes_.html




#161065 ABI 7300 qRT-PCR and ddCT protocol

Posted by jerryshelly1 on 09 October 2013 - 05:59 AM in PCR Reagents and Equipments

Academic institutions keeps receipts for ages.  If ABI is not willing to show you their original purchase receipt, find your institutions.  You can also usually get some leeway if you mention that you use there chemicals, plates, films for the machine and mention that many other companies make more suitable replacements. It has work for me with some things. I guess it just depends on the overall cost of the product.




#166817 Another one from this weird webpage

Posted by jerryshelly1 on 08 April 2014 - 10:46 AM in Lab Jokes

Haha. I saw that on Reddit a couple of days ago. 




#165684 Autoclaving microcentrifuge / eppendorf tubes

Posted by jerryshelly1 on 03 March 2014 - 08:50 AM in General Lab Techniques

We usually put the tubes in a Nalgene container able to withstand higher temperatures (121C). This container can be an open top that you can place aluminum foil over or it can be a sealable container. To verify that the autoclave reached the appropriate temperature, we use heat/pressure sensitive tape. The cycling conditions vary, but we usually do 15-30 minutes depending upon the volume.




#159695 Autoclaving water to go into the incubator

Posted by jerryshelly1 on 30 August 2013 - 09:06 AM in Tissue and Cell Culture

 

Same here. We autoclave regular tap water and supplement the water with SDS. Distilled and Milli-Q water will rust your incubator.

 

What is the purpose of adding SDS? As an anti-bacterial?

 

We have seen it reduce the growth of bacteria. It is especially helpful if someone accidently splashes media into the water tray.




#164229 blood collection tubes for xenograft exp

Posted by jerryshelly1 on 16 January 2014 - 11:53 AM in Hematology

I am going to answer because no one else has. We use EDTA tubes because it acts as an anticoagulant and chelator, which is great for handling the blood at RT and downstream PCR studies. We have also used citrate tubes and seen no notable difference.  I would say that you wouldn't want to use EDTA because it will chelate any metals that are present in the animals blood stream. That would be the only negative effect of the EDTA as chelation therapy has been approved by the FDA.

 

If you are a hospital oriented research center it may be beneficial to get into contact with the hospitals chem department and they can walk you through which color cap tube may be best for your studies.  The below link is the only relevant literature I could find on the subject.

 

http://mujhu.org/hom...uide_VS5229.pdf

 

Let me know what you find out as this could benefit me in the future




#161769 Blunt end is ligating to sticky end?

Posted by jerryshelly1 on 28 October 2013 - 09:32 AM in Molecular Cloning

When you generated your new insert, did you purify it or does it still contain the DNA polymerase.  Could it be possible that your plasmid is recircularizing with the T4 ligase and then the polymerase is filling in the gap? The ligation would be energy favorable, but would your polymerase function?




#161035 Calcutation question

Posted by jerryshelly1 on 08 October 2013 - 12:27 PM in Tissue and Cell Culture

You just need to pick a total final volume and make all other calculations based on that. You want your total volume to be 1mL of media? Make all of your calculations based on 1mL of media and subtract the amount of stimulator A, B and C from your 1mL of media. 

 

Do you need to add your stimulators at different time points or are they all added at the exact same time.  If they are added at different time points, the 10.2uL difference will be negligible as the amount of stimulator A will have decreased due to your cells consuming it.

 

Does this make sense?




#160916 Calibrator sample has zero expression of target gene.

Posted by jerryshelly1 on 04 October 2013 - 06:56 AM in Molecular Biology

Are you trying to compare the fold increase of your cytokine at time point zero vs. a later time point?

 

There are a couple of different ways you can approach your quantification depending on what you are trying to show.  Does the treatment of your sample suddenly switch on your cytokine or is your cytokine usually differentially expressed? Are you trying to compare your cytokine expression to the expression of a common ubiquitous cytokine?




#165296 can buffer ever go bad?

Posted by jerryshelly1 on 21 February 2014 - 09:18 AM in Tissue and Cell Culture

Aside from contamination and precipitation, you should be fine.




#165542 can i use 50ml tube contain isopropanol alchol

Posted by jerryshelly1 on 26 February 2014 - 10:16 AM in Tissue and Cell Culture

I wouldn't put the cryovial into direct contact with the isopropanol. A good substitute would be to put the cryovial in the old Styrofoam that was used to house 15mL tubes.

 

I never put my lymphocytes in the -20C before placing them in the -80C.




#160319 Can protein isomers be detected in SDS-PAGE

Posted by jerryshelly1 on 17 September 2013 - 08:39 AM in SDS-PAGE and Western Blotting

The two replies above are spot on.  Depending on the amount of information on your protein, I use http://dbptm.mbc.nctu.edu.tw/. This will tell you all of the experimentally determined post-translational modification sites that are on your protein of interest.  From here you can use inhibitors to see if they alleviate the more prominent band.




#161650 Cannot clone 2kb insert into pENTR D TOPO cloning vector

Posted by jerryshelly1 on 24 October 2013 - 12:58 PM in Molecular Cloning

You could nanodrop your PCR sample or use a DNA specific fluorometer for an exact reading; however, using HindIII for densitometery is an alright method.

 

Increasing the reaction time could potentially help you. You may just run the reaction until the enzymes are dead, but it shouldn't hurt you overall.

 

Sometimes colleagues prepare the wrong concentration of antibiotics. Double check and make sure you are adding the appropriate concentration. 

 

Can you share the gene you are trying to TOPO?

 

Edit - One more question... Can you cut out your gene from your other plasmid using a blunt RE? Phusion polymerase is amazing, but maybe something funky is going on.




#161647 Cannot clone 2kb insert into pENTR D TOPO cloning vector

Posted by jerryshelly1 on 24 October 2013 - 12:33 PM in Molecular Cloning

The ratio refers to the amount of vector to the amount of insert, i.e. 1:1, 1:3, etc...

 

You have used this kit with the provided control and are sure that it works?

 

I have used sticky end based TOPO kits and have had varying success depending on the gene. Double check and make sure you are correctly calculating the concentration/ratio of your vector and insert. If varying the ratio of the vector:insert doesn't work, I would consider increasing the TOPO reaction time.

 

You could feed your insert though a secondary structure prediction program and see if it is forming a weird structure that is impeding proper ligation... but this is probably has nothing to do with your problem.

 

How many colonies did you test?




#162081 cDNA not enough-variability

Posted by jerryshelly1 on 04 November 2013 - 08:33 AM in PCR, RT-PCR and Real-Time PCR

You can remake the cDNa and compare it to your previous run. Just make sure you use a control and that you keep your conditions consistent. If you are worried, run a couple of different normalizes during each qPCR and this will help convince you that your cDNA is consistent.




#160776 cDNA preparation from degraded RNA

Posted by jerryshelly1 on 30 September 2013 - 05:59 AM in Molecular Biology

Do you see the 50bp product in your controls without primer? You have used this primer before with no additional bands or is this a recently designed primer? Does the appearance of the additional band only occur with this sample?




#164279 Cell Lysate Western Blot Little or No Signal

Posted by jerryshelly1 on 17 January 2014 - 07:46 AM in Protein and Proteomics

That may work. If you didn't know... This website (http://highwire.stanford.edu/) is a really good reference when you like to search by key words. Maybe try searching for your protein + cos7 + lysis to see what pops up.




#164254 Cell Lysate Western Blot Little or No Signal

Posted by jerryshelly1 on 16 January 2014 - 05:26 PM in Protein and Proteomics

It is definitely a possibility. That particular protein may be more susceptible to sonication than other proteins. A quick check would be to prepare your purified protein in the same manner (even though it is already purified). You could potentially take 100ng of your purified protein and add the lysis buffer and sonicate. Run your samples on a dot blot and see if this destroyed the antibody recognition site. I only suggest doing a dot blot because they can be completed within 3hrs as compared to a two day western blot (depending on your protocol).

 

Have you tried just adding lysis buffer to your Cos-7 cells, mildly vortexing, and incubating on ice for 30 minutes, spinning down and removing the supernatant? This is significantly milder than sonication and may or may not solve your problem.

 

If your protocol was given to you and sonication has worked in the past, maybe you should double check your output settings.

 

I haven't worked with Cos-7 cells, but I do work with HEK cells quite frequently.

 

Edit - Is this protein expressed from a plasmid that you transfected? If it is, maybe you should take a step back and see if you have mRNA expression via a quick PCR reaction. You don't make it clear as to whether you purified the protein or if the protein is a manufacturer recombinant protein.




#164210 Cell Lysate Western Blot Little or No Signal

Posted by jerryshelly1 on 16 January 2014 - 09:33 AM in Protein and Proteomics

60ug is quite a bit a protein and at that concentration you should have no trouble getting a very robust actin band.  If you are getting a decent signal from your positive control on the same blot, you can probably rule out everything post protein denaturing (check your blot via poncea-S and commassie stain your gel post transfer, just to make sure something funky didn't happen - very unlikely though).

 

If I were you, I would harvest more cells and do a milder protein extraction. Is this your first time working with these cells?




#167169 ChIP Buffers

Posted by jerryshelly1 on 21 April 2014 - 06:30 AM in ChIP and Next Generation Sequencing

I found three references that look like they give a decent background on ChIP. You essentially are trying to wash away any non specific binding that is occurring. This will ensure that your downstream qPCR signal is from your antibody binding to your target.

 

http://docs.abcam.co...ide-to-ChIP.pdf

 

http://www.millipore...ech1/tp5994en00

 

http://www.promega.j...chap6.pdf?la=en




#162465 cloning

Posted by jerryshelly1 on 14 November 2013 - 12:14 PM in Molecular Biology

Hey,

 

I forgot to mention that adding 3bp is only done to the 5' or 3' end of your restriction site because some enzymes require larger overhangs for efficient cutting. You can access the cleavage efficiency close to DNA ends on the NEB website (https://www.neb.com/...f-dna-fragments).

 

Your primers look good, but I would change a couple of things...

 

The underline portions are not necessary. The overhang is required on the 5' end to ensure efficient cleavage.

5' - TATggatccGCCATGAAAAAGACAGCTATCGCG

5' - ATAggatccGCCATGAAAAAGACAGCTATCGCG

5' - CGCGTggatccGCCATGAAAAAGACAGCTATCGCG

5' - CGCggatccGCCATGAAAAAGACAGCTATCGCG

 

I would use...

 

Forward primer with BamHI (3bp overhang):

 

5' - ATAGGATCCATGAAAAAGACAGCTATCGCG - 3'

 

IDT Oligo Analyzer

 

ENGTH: 29 GC CONTENT: 44.8 % MELT TEMP: 60.0 ºC MOLECULAR 
WEIGHT:
8943.9 g/mole EXTINCTION 
COEFFICIENT:
295400 L/(mole·cm) nmole/OD260: 3.39 µg/OD260: 30.28

 

Reverse primer with PstI (2bp overhang):

 

5'-ATCTGCAGTCACTATGCTGCACAG-3'  

 

LENGTH: 24 GC CONTENT: 50.0 % MELT TEMP: 59.2 ºC MOLECULAR 
WEIGHT:
7312.8 g/mole EXTINCTION 
COEFFICIENT:
227000 L/(mole·cm) nmole/OD260: 4.41 µg/OD260: 32.21

 

 

 

*You should double check and make sure if your plasmid will epitope tag your GOI. If it does, you need to consider if it will be at the 5' or 3' end of your gene.




#162457 cloning

Posted by jerryshelly1 on 14 November 2013 - 09:30 AM in Molecular Biology

You can't digest with an enzyme if the restriction site is not there. What you will have to do is design primers that can put a 3' SalI or PstI site on your GOI. You will not be able to simply cut out your GOI.

 

Design two primers...

 

Forward Primer:

3bp random nucleotides - XbaI - 5' GOI (10-20 nucleotides)

 

Reverse Primer:

3bp random nucleotides - SalI/PstI - 3' GOI (10-20 nucleotides)

 

You can easily PCR your GOI, cut with the two restriction enzymes, purify and stick it into your new vector.

 

Good luck!





Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.