siRNA /shRNA agains EGFP - (Sep/14/2005 )

Hi!


I have to construct a shRNA plasmid agains EGFP (enhanced green fluorescent protein) as a control. Does anyone know a sequence that works well so that i don't have to test many different target sequences?

Thanks for your help!

Stardust

here is sequence to GFP :

cuggaguugucccaauuccTT
agaauugggacaacuccagTT
in Use of RNA-interference-mediated gene silencing and adenoviral overexpression to Elucidate the roles of AKT/PKB-isoforms in insulin actions.

Firstly: Thanks for your answer!

I tried to find the siRNA sequence in my plasmid maps (pEGFP-N3 and pEGFP-C1) but could not find it...any explanation for that? Have you used these sequences yourself? Did they work?

I think the sequence you have posted is against GFP not EGFP... is that possible?

yes i've change my previous topic.
Here is the sequence and the appropriate reference :

aagctgaccctgaagttcatc

ref : Biochem Biophys Res Commun 2003 Feb 14;301(3):704-10 / Mammalian actin binding protein 1 is essential for endocytosis but not lamellipodia formation: functional analysis by RNA interference. Mise-Omata S, Montagne B, Deckert M, Wienands J, Acuto O

fred

btw, i've crated a topic including 2 siRNA databases.

Insert from OpenBiosystem's shRNA eGFP Positive PSM2 vector Control:

TGCTGTTGACAGTGAGCGAGCACAAGCTGGAGTACAACTATAGTGAAGCCACAGATGTA TAGTTGTACTCCAGCTTGTGCCTGCCT ACTGCCTCGGA

The short hairpin is cleaved by dicer and exportin-5 mediates transport to cytoplasm. I have used this vector to knockdown 75% eGFP fluorescence from a stable expression peGFP-N1 HEK293 cell line. The effect took 4-5 days for apparent knockdown because of the kinetic stabilty of eGFP. Try destabilized eGFP for a quicker observable knockdown result.