cloning problems - cloning problems (Aug/17/2005 )
Hi everyone,
I'm trying to clone a .6kb Celegans gene into Invitrogen's pCR 2.1 TA cloning vector. The vector was designed to have EcoR1 sites flanking the area where your insert goes. I sequenced a clone, and it looks perfect, except it is missing about the first 20 nucleotides. Someone told me this is common with clones, to just loose the front end spontaneously. Has anyone else heard of this? Any recommendations?
Neil Stewart
hi
thats interesting
i have cloned my gene into puc19 with hincII and EcorI and i am doing to sequence it tomorrow. hope i dont loose any such fragment.
i will find out why such things happen
do u have any idea is it a charecteristic of vector or ur insert
prajwal
I already heard somethink like that,too. In order to be sure, I think you should try another TA cloning kit, probably the result will be different.
Good Luck 
I'm trying to clone a .6kb Celegans gene into Invitrogen's pCR 2.1 TA cloning vector. The vector was designed to have EcoR1 sites flanking the area where your insert goes. I sequenced a clone, and it looks perfect, except it is missing about the first 20 nucleotides. Someone told me this is common with clones, to just loose the front end spontaneously. Has anyone else heard of this? Any recommendations?
Neil Stewart
I'm trying to clone a .6kb Celegans gene into Invitrogen's pCR 2.1 TA cloning vector. The vector was designed to have EcoR1 sites flanking the area where your insert goes. I sequenced a clone, and it looks perfect, except it is missing about the first 20 nucleotides. Someone told me this is common with clones, to just loose the front end spontaneously. Has anyone else heard of this? Any recommendations?
Neil Stewart
You'll loose the first 20bp of your sequence but that does not necessarily mean you actually lost the DNA. When sequencing, sometimes the first 10-30bp of sequence is junk. Sometimes more depending on sequencing conditions. Pick a sequencing primers further back from the cloning site and resequence. Cut out your band and run it on a higher percentage gel. With the proper controls you should be able to distinguish and 20bp difference if it does exist.
Dear all:
We have a trouble with sequence analysis that intrigue us:
A 585 bp fragment was successfully TA cloned from mouse mRNA into a pcDNA3.1/NT-GFP-TOPO vector, as the PCR analysis shows. The 6762 bp supercoiled construction was sent to sequence with a primer which hybridizes exactly at the 3' end of the cloned fragment. All the sequence seems perfect from 3' to the 5' end of the cloned insert, and shows the correct nucleotides of the vector following the 5' end of the insert. The problem is that a 22 bp sequence including the 21 bp of the 5' primer used for the original cloning is missing. We repeated the process two more times with the same results. In the other hand, the PCR analysis of the clone amplifies the expected 585 bp by using the same primers for the original cloning, including the 5' primer whose sequence disappeared from the sequencing.
The cloning was repeated onto a pENTR/D-TOPO, and then recombined with a pLenti4/TO/V5-DEST vector. A 669 bp fragment was PCR amplified by using a different 5' primer than the one used in the pcDNA3.1 cloning, but the same 3' primer. The 5' primer that hybridizes to the 5' end of this fragment was used to sequence at the same facility than the pcDNA3.1. All the sequence of the insert and surrounding vector's nucleotides are perfect, but the same 22 bp missing in the pcDNA3.1 sequencing disappeared again, while the PCR (that uses the 5' primer which sequence is absent) was perfect.
The missing sequence is (5'-3'): ATGGATACAGCACCTGCATCCC
It has not very much CG, but forms some loop.
Is it possibly to have some secondary structure that avoids the sequencing polymerase to pass, but allows ours?
Any comment would be greatly appreciated
Cheers
Good sequence is only obtained starting around 20-30 bp 3' of the end of the primer. If you make a primer which binds to the exact end of your sequence, you will get no sequence information for that region, nor (usually) the next 20-30 bp 3' of the end of the primer. It sounds as if you are getting sequence starting very near the 3' end of your primer, which is unusually good. Almost all sequencing is done using primers which bind to the vector backbone, typically 30-50 bp away from the cloning site, to avoid the problem you are seeing. This also allows the use of a standard primer, the same for all parts cloned into that vector. Be happy, your clone sounds as if it is exactly correct.
Thanks for answering, phage434!
It’s a relief to hear something like that. Yes, I omitted that detail: we don’t get the exact sequence from both ends, including the primers’ sequences, but indeed we get the expected sequence some tens bp forward. About sequencing with a primer binding the vector backbone, we were unable since we have not such primers.
Our major interest was to know the region including the fusion of the insert and the vector, and know about the correct ORF of our insert sequence and the GFP one. Somebody told us to restrict the construction with a nuclease specific for the 22 bp sequence. We find it good idea.
Any suggestion? 
Thanks so much, guys! 
I think I would want to see the sequence so i would design and sequence with primers upstream from your ends.
Hello, guys!
Stevo, here's the sequence you asked for. Sorry for the delay...
I've just realized a mistake:
In the sequence analysis of the pLenti4/TO/V5-DEST construction, we lack of only the 20 bp of the 5' primer. The next two expected citosines are substituted in the analysis by two timines. The expected CGG inmediately before the 5' oligo are changed by GGC. In the former sequencing of the pcDNA3.1 construction, we lack of the 20 bp from the 5' oligo, but also of the next two nucleotides (for a total of 22 bp missing). 3 bp before the cloning site, a citosine was substituted by a timine. So, both constructions have substitutions of basis, but keep the correct nucleotide number, how common is that?
Too thanks for helping
Best