Digest pUAST vector with two restriction site too closely located - too closed sites for double digest (Feb/02/2005 )

Does anybody know pUAST vector? I want to insert a 1.2kb fragment from
PCRII-vector into pUAST vector, I only have two choices, one is double digest using XbaI and KpnI, the other is double digest using KpnI and XhoI, which one is more better?
Actually this two double digest sites in pUAST vector are all too close. I didn't use this vector before, who knows if the above options are OK? Thanks. Here is the link of pUAST.

http://www.gurdon.cam.ac.uk/~brandlab/reagents/pUAST.html

I have used the pUAST vector but your question applies to anyone who does cloning.

personally, I haven't been in the situation where I am forced to use two adjacent RE sites on the multicloning site and I try to avoid it. If they are too close, only one enzyme may be able to cut it, due to overlap of recognition sequences or the need for a number of bases on both sites of the RE sequence for efficient cutting.

I'd try to look for other restriction sites on your insert that have compatible ends with the RE sites in the MCS.

HI

your sequence is GCCGCGCTCGAGGGTACCTCTAGA

Well the best i can tell you is to make a first digest by Kpn1 (NEB Buffer 1 + BSA). You can then precipitate the linearized vector (NaAcetate / Ethanol). You resuspend your precipitate in 89µl ddH20, add 1µl Xho1 and 10µl buffer 2 + BSA 0.2µl. Normally a digest will occurs overnight.

Tell me if it helps you.
good luck

fred_33 and george@CASE. Thank you very much for your reply. My foreign gene fragment has be inserted in the black part of pcr product on PCII-TOPO vector, here is vector picture link: http://est.ym.edu.tw/est/pcriitopo_map.pdf, the inserted foreign gene sequence is from ATGGAAGTTC start to GTGTTCTTA end. Now I am going to insert this foreign gene fragment to pUAST vector (here is link: http://www.gurdon.cam.ac.uk/~brandlab/reagents/pUAST.html ). I just want to double check if inserting the fragment into between XbaI and KpnI or KpnI and XhoI are OK?

your strategy sounds good, I will do sequential digestion, and I will let you know when I work it out. Thanks a lot.

I am still worried that the RE sites on pUAST are too close to each other for efficient cutting. I would do an overnight digestion like fred_33 said just to maximize the double-digested pUAST.

by the way, PCRII-TOPO accepts PCR products in a non-directional manner so your primer can insert both ways (either reading left-to-right or right-to-left). It is important in pUAST that your insert be oriented in the right direction so that the coding region is properly read.

george@CASE, Thank you. I worried that the RE sites on pUAST are too close to each other for efficient cutting too. But I don't have choice. I have to choose pUAST.

You are right, the orientation of insert gene on the pUAST is really important, that is my concern. After I did digest analysis of inserted gene fragment on PCRII-TOPO using EcoR I, I confirmed that I got right size of inserted gene, I also did PCR using M13 forward primer and left primer (ATGGAAGTTC) of inserted gene fragment, I confirmed that I got the right orientation of inserted gene on PCRII-TOPO. Now I will do is to insert the fragment in the right direction on pUAST. There are only two options for RE sites on pUAST base on the RE sites of my insert gene, they are XbaI and KpnI or KpnI and XhoI. Now I don't think XbaI and KpnI are right choice since the coding region of insert gene is not properly read, am I right??

Now I only have one choice using KpnI and XhoI. My inserted gene is from start code ATGGAAGTTC start, and include 5 exon to GTGTTCTTA end. If I am not right, please correct me.

http://est.ym.edu.tw/est/pcriitopo_map.pdf

http://www.gurdon.cam.ac.uk/~brandlab/reagents/pUAST.html

Thanks a lot.

Thanks fred_33, your suggestion works well.

hi
congratulations.

fred