PCR troubleshooting - (Dec/17/2008 )
HI EVERYONE,
I can get very bright products with genome as template in my first PCR.
I do the second PCR with the products from the first PCR amplication as template.
The second PCR yields are very fuzzy!
So I suspect that my target sequence has complicated secondary structure.
I check the minimum free energy with DNAMAN and it is -84kcal/mol.
But 60% of my target sequence are AT bases.
WHAT`S WRONG WITH MY PCR?
THANK YOU FOR ANY ADVICE.
Have you tried a touchdown PCR?
Are you sure the bands you are looking at are your amplified regions. Primers come up fuzzy on DNA gels (if by fuzzy you are talking about how the DNA bands look on a gel).
MIght be good to attach an image of your PCR product. it will help us to help u
MIght be good to attach an image of your PCR product. it will help us to help u
hehe,thanks.
The first picture is the result of PCR from genome.The brightest band has the same size of my target sequence.
The second picture is the second PCR.
F-PRIMERS:GTCAGTTATACTATTTGTGTT Tm=53 ℃
R-PRIMERS: CGGTGAGTCTAGTTCCTGCTT Tm=53.1 ℃
94℃ 2min; 5 cycles of (94℃ 1min,53℃ 30 s, 68℃ 1min);30 cycles of (94℃ 1min,50℃ 30 s, 68℃ 1min);72℃ 10 min.
1) Why are you doing a second PCR, since the first one looks good.
2) The second one looks like it failed completely, not that it is fuzzy.
3) I never (well, rarely) have success in a second PCR with the same primers. If you need to do a second round of PCR, use nested or semi-nested primers.
4) The likely problem is that you are using too much DNA (or impure product) in the second round. Dilute by lots if you need to do the second round (for reasons I don't understand).
Even if ur second primer didn't anneal properly, at least ur template DNA band should seen in the second gel. But there is nothing like and I used to get this type of gel only if I have some nuclease contamination in any of the buffer or any reagents we use. Better check for that.
I doubt ur 2nd reaction is working at all. The faint band is to me just a diluted version of the product u got from your first reaction.
You could try dilute the sample as per phage434 or wash the sample and proceed to PCR.
Do you clean the first PCR product before you use it again? Could it be that it is lost during the cleaning step?
Cheers!
say to phage434: I cant repeat the result of the first PCR once more.My wanted band just appeared only one time.In the second picture,the target band is very faint.I have done the second PCR with the same primers successfully when the result of the first PCR was very faint or even no band at all.
say to cadbury:But we can see few faint nonspecific bands in the third picture.
say to hanming86: I have used out all the first PCR result buffer already.I cant repeat the result again.Oh,my god,I dont know what is the matter with me?!
say to wolverena:I added the first PCR result buffer directly.