PCR troubleshooting - (Oct/15/2008 )

I've to PCR a 3.1kb gene,but Im not getting it. I don't know what the problem is?
The Tm of primers is 82.2 & 85 & I set the annealing temp to be 75 deg (for 30 sec). Denaturation was at 94 deg for 30 sec & extension was at 72 deg for 3 min.
Is the Tm too high?
Can anyone plz help me ?

---

I would drop your annealing temperature - normally i use between 55-60C for at least 1 min and I don't pay much attention to the Tm of primers (although I know that some people do). Also you should be using 1 min of extension for each kb of product, so for your 3.1 kb product you should let it go at least 3.5-4 min rather than 3 min which is cutting it pretty close.

---

For such a long product I would use hot start polymerase Phusion from Finnzymes or any other. With Pfu or Taq polymerases I never get the right band (eg. 2.7kb). The Phusion hot start is very fast and precise.
Good luck :-)

---

you should also specify what kind of template you have.
and could you go to there measure your annealing temperature and post it again?
tell us as well for how many cycle your amplification is running.

---

What are the sequences of the primers?

---

To short time for the denature and anneling for a big amplicon. You are not giving enough time to the strands to open properly so the primers could anneal. Also there is a difference of 7-10C between the primers Tm and temp of annealing it should be around the Tm (for must samples). Have you try an annealing of 80-82C?? try to find a thermocycler with temp gradient to find the correct temp annealing, will save lots of time.
94C-50sec-1min
80C-1 min
72C-2 min

---

Think you can redesign your primer?

is this your primer's Tm or the Tm after having Restriction site and other non-annealing site on the primer?

---

From the Finnzymes website, the Tm comes out to be 85.9 & 82.2.

---

The sequence of my primers is
5' CCCCCCCCCAGATCTTGATGGCCAACTGCCAAAT 3'

5' CCCCCCCCCTTCGAATTAAGGACTCGGGTCAAAT 3'


Im doing 30 cycles for amplification.

---

This pair of primers don't look good to me.

1.no GC clamp at the end.both ends with AAAT ( weak bonding )

What's the purpose of putting so many CCCCCCCCC at your primer? that's the main cause of having high Tm .

I couldn't locate any usual restriction site on the primer.usually all these extra bp is for helping restriction enzyme to dock on the PCR product.

---