No PCR product visualized using quikchange kit - (Sep/26/2008 )
I would like to ask some question about PCR reaction of Quikchange...
The problem I hv got with the kit is that most of my PCR reaction got no PCR product after PCR and DpnI digestion, only one got the product
One pair of my unsuccessful primer is: F 5'CTAGGACTACTGGAAACTGCCAGTCCTTCGTCCTTC3'
which has 2bp mismatch
One pair of my successful primer is F 5' CTAAGAATAAGGAAAGCGCAGAACATATTGATTGG3' which has 3bp mismatch
The plasmid I am using has a length of 3.6kb and my cloned gene has 1.3kb
The PCR cycle I used has followed the manual of the kit and I have tried lower annealing temperature at 46C but still don't have a band seen after agarose gel electrophoresis
I know that the Tm of my primers is below the min. requirement of the kit, but my boss said that the kit worked prefectly even the primer has a lower Tm...
I really appreciate if someone could give me some suggestions about it!
The annealling is tooooooo lowwwwww for your primers (If i count well) one have 110C and the other 96C so the anneling temp for the reaction should be around 103 (by math). The problem of this is DNA denature around at 90's. So reaction can't be at so high temp. If I read well it should be around 80C for this type of assay so 46 is to low. If around 80C don't funcion try to redesign the primers (eliminate some nucleotides) so the anneling is aprox 80C. Another thing try that the last and first nuclotide don't compliment with each other like the "succesful"primer with C a 5'&G at 3' they could bind.
Isn't the higher Tm could lead to a better binding of the primer to the template..? therefore even the primer was not binding to the correct site, there would still have the product produced?
Also, by seeing the Tm provided by the primer provider, the Tm of my unsuccessful primers are 70.9 and the Tm of my successful primers are 66.4 without taking account of the mismatch bp...and therefore the Tm should be even lower...
However, when I use the Tm calculator provided by Stratagene, http://www.stratagene.com/QPCR/tmCalc.aspx, both pairs of primers is higher than 78C also.
Successful primers
Primer Length 36
base pair changes 2
# of Gs and Cs 19
Unsuccessful primers
Primer Length 35
base pair changes 3
# of Gs and Cs 13
Before trying 46C, I also have tried 52C, this shouldnt be too low for the reaction?
However I still cannot get the band.
I am a grad student doing a FYP, this kit I am using is really expensive, I have done a number of unsuccessful reactions, this is really wasteful...so it will be really grateful if I can solve this problem earlier...
Sometime low Tm lead to a not expecific binding and you will see a lots of bands like a molecular ruler, but not always you will see this. Thinking a little more about your problem other parameter that should be take account is how fast or slow the thermocycler change temp. Your primers are longer than usual for a normal pcr 18-25 mer are ok but you have more than 25 mer, there is a possibility that if the change of temp is to fast primers don't anneal correctly and "fell off" the strand. Check is your machine has "ramps" and add a ramp between denature and annealing and decrease the rate of temp changing, begin with 10-15%. Tell me what you are adding (reagents) to the reaction, the size expected for the amplicon and the program of the thermalcycler so I could see the whole picture better. if have a picture of the results will be a plus.
I've had issues getting pcr product using this quikchange protocol. What I had to do was set up the pcr in a variety of buffers and found that I only got product with buffer that had high pH, and low MgCl2 and KCl. It's time staking to make all the different buffers but once you have them you can optimize just about any pcr so I think it's worth the time to make them and store at -20.
Buffer / Tris-HCl(100mM)pH/ MgCl2(mM) / KCl(mM)
A / 8.3 / 15 / 250
B / 8.3 / 15 / 750
C / 8.3 / 35 / 250
D / 8.3 / 35 / 750
E-H pH 8.7 with same pattern of different salt concentrations
I-L pH 9.0 with same pattern of different salt concentrations
All need to contain 0.1% TX-100 detergent.
Try making these up and testing your pcr with the suggested annealing temp. I assure you one will work. My Tm of primers was WAY higher than suggested and I was able to get this to work so I'm sure your primers are fine. By the way, you don't need the kit for this. Just the good polymerase and DpnI which can both be bought much cheaper from other vendors. It's just the concept but just so you know, I used this protocol to delete 74 amino acids from my gene in one pcr so you can do much more than just single base changes!
One of the formulation I have tried:
PfuTurbo® DNA polymerase 0.4 ul
10x reaction buffer 2 ul
primers F&R 2uM
dNTP 0.2mM
DNA template 400ng
Final volume 20ul
Temp Cycle
95C 30s
(95C 30s
52C 1 min
68C 10 min) x 24 cycles
68C 10 min
4 C forever
Above is the formulation that was sucessfully done by my condisciple (A project which is similar with the one I am doing, therefore it is supposed to be ok in this case too), which is much higher in primer and DNA concentration with a smaller reaction mixture volume than the protocol provided by Stratagene, however it did not work for me. Also I have tried the protocol of Stratagene, also it did not work also.
The expected size of the product should be about 4.9kb.
One of the pic of my gel electrophoresis and the product should be located around the red arrow(sorry that the marker did not run well due to poor gel preparing):

The above pic is the electrophoresis of the 3 PCR product. In the 3 PCR reactions, reagents added are the same (stated above)but with diifferent annealing temperature which are 44, 46, 48C respectively from left to right (due to the unsuccessful experience of 52C, my boss suggested me to do a gradient). After my boss saw the pic, he said that it should not be the product he want...
I don't know whether it is the problem of the reagents or my technique, if that is the problem of my technique, there is one pair of primer worked, anyway it is really frustrating.
Buffer / Tris-HCl(100mM)pH/ MgCl2(mM) / KCl(mM)
A / 8.3 / 15 / 250
B / 8.3 / 15 / 750
C / 8.3 / 35 / 250
D / 8.3 / 35 / 750
E-H pH 8.7 with same pattern of different salt concentrations
I-L pH 9.0 with same pattern of different salt concentrations
All need to contain 0.1% TX-100 detergent.
Try making these up and testing your pcr with the suggested annealing temp. I assure you one will work. My Tm of primers was WAY higher than suggested and I was able to get this to work so I'm sure your primers are fine. By the way, you don't need the kit for this. Just the good polymerase and DpnI which can both be bought much cheaper from other vendors. It's just the concept but just so you know, I used this protocol to delete 74 amino acids from my gene in one pcr so you can do much more than just single base changes!
Thanks for the suggestion!
However there is too many reactions to be tested...I think if I suggest this to my boss...He may gone crazy...as I have already done a lot of wastful reactions....
Also is that the buffer provided in the quikchange kit do not always works for every reaction...? But my condisciple really successed in the reactions which are similar to the reaction I am doing (mutations next to the sites i am working)...Is that really need a visible PCR product on gel before performing a successful transformation?
Is there really no other suggestions...
?
The final question for me is that if there anyone tried a successful transformation without a visible band in electrophoresis after DpnI disgestion...?
thx! : ![]()
The final question for me is that if there anyone tried a successful transformation without a visible band in electrophoresis after DpnI disgestion...?
thx! :
The cycle number of the PCRs with this kit might not be enough to see a product... especially since you are amplifying an entire plasmid (supercoil does crazy things on a gel).
I never check for PCR product when I use this kit and just go ahead and transform some of the DpnI digestion product and sequence minipreps of a number of colonies... I usually have very high incidences of mutation/insertion/deletion incorporated.
I would say go ahead and seqeunce a few and see if it worked before worrying about PCR conditions and how much PCR product you got.
For such a "huge" expected amplicon your PCR conditions are more suitable for a less tha 1kb amplicon.
95C for more than 3 min (check if the polymerase is a hot start or not (if a HS increase time up to 15 min)
94C 45sec-1min (maybe a little bit more if DNA is supercoiled)
anneal at a temp more near the Tm of the primers maybe 2-5 degrees (more or less) and for more than 1 min (70-80 sec) your primers are long. If the annealing temp is so low (40'sC) then use a ramp between denat and annealing (decrease speed of temp change for 10-15%)
72C for 2-5 min
Try to use at least 35 cycles
72C 15 min. 1X
4C-10C hold
Good luck!!!