primers sequence - (Sep/03/2008 )

want to know can i use this two set of primers to identify the same gene or not:

set 1:
forward 5’ (TGG CGT GTC TAT TGA CGA CGA GC) 3’ (?)
reverse 5’ (CCT GCT GCG CAT TCA CCA TG) 3

Set 2:

F 5'(TGGCGTGTCTATTGACAGCGAGC)3'

R 5'(CCTGCTGGGCATACTTCACCATG)3'. (292bp)



the story of this primers is as follow:

This two primers were used to identify H. pylori strains ..specific for 26KDa species specific antigen gene... when i was choose the primers idid not notice that they are different .. and i orderd the latest one which is set 2 cause it is in 2005. it work and it give me results a band in the same size of the set 1... the problem in the set 2 that they dont mention the product size just they put this figure. and also most op people work on set 1

I imagine that you will be able to amplify the gene with the second set but just realize that you are introducing mutations with both and an extra codon with the reverse. What effects will this have and can you be sure that any data you obtain using this mutated pcr product is not an artifact of said mutations??? Honestly, I think you are best off starting over and reordering your primers. Not much is worse that to do a year or two or three of work and find out that everything is an artifact. Better to start off with reagents you are confident in and know are correct. Besides, if most people in the field work with set 1, you may run into reviewers (when you go to publish) that will not accept your mutated primers and reject the paper.

Hi thanks 4 the information u provided to me....
Sorry i used set 1 instead of set 2 and set 2 is widely used in research....
it seem like both set give the same product size 292bp this is wt i get... the test which i do it by this primers is conformation test for presence of H. pylori (primary test was rapid urease test) .. also what make me said that this primers was working good is that iam searching for cagA gene present just in H. pylori ....and i found it in most of the PCR positive PCR... also the PCR results is match with clo test ad was significant. Iam master student and i finish my laboratory work iam writing know my thesis i want to know how both set amplify the same gene and the sequence r diffrent... Iknow that polymerase enzyme work from 5' to 3' and the sequence at 3' in both set are almost same.. but is the explanation of this... both set r using for rapid identification of h.pylori by PCR... set 1 just one publication.. and iam the second one who use this primers.... set two lot of pulication and by combaring the data are exactly same