DNA elongation in PCR - Multidirectional? (Sep/03/2008 )

Hi everyone,

I have trouble visualizing PCR process when two primers (namely forward and reverse) are involved. Polymerase will add to the existing 3' end of the primer (see below)

5' //AGG_______________CGC// 3'
3' //TCCGAAGATATCGCCTATGCG// 5' (template; target region of genome)

Elongation with occur from left to right beginning at the imaginary forward primer (AGG).

Now, say we have another imaginary reverse primer with CGC as the bases: No way polymerase is going to go from right to left.

Understanding this is going to help me with the sequencing results in the future since it uses both the F and R primers too.

Appreciate all the help I'd get. Thanks all.

---

assuming your template is dsDNA and using the sequences you suggested, this is how it'll look.


5' // AGGCTTCTATAGCGGTATGCG // 3' (template, sense strand)
3' // TCCGAAGATATCGCCTATGCG // 5' (template; antisense strand)

forward primer: 5' // AGG
reverse primer: 5'// CGC


now, your forward primer as you said will bind at the 3' end of the antisense strand as the polymerase will go from 3' to 5' generating the complentary strand (sens)

5' primer // AGG ->
target 3' // TCCGAAGATATCGCCTATGCG // 5'

now for the sense strand, your reverse primer will again bind at the 5', and the polymerase will again go from 3' to 5'

5' // AGGCTTCTATAGCGGTATGCG // 3' target
<- CGC // 5'


Hope it helps, definitely need to be able to visualise this to understand sequencing.

---

Thanks Doctor. It helps. So, its actually the annealing of primers to two different strands of the DNA. What causes my initial problem in visualizing is the fact that primers can carry restriction sites so I thought the primers would have to bind left and right on the same target region so as to produce two RE sites flanking the amplified region.

---