how to clone my insert DNA into vector? - (Aug/06/2008 )

hello everyone, i am a new ppl in biotech field, hope u all can give me a hand on this.

the situation here is, i need to isolate a gene from bacteria. so in the end i would need to sequence it.

i would like to cloned the gene that i amplified from bacteria into a vector, and do transformation, then do a Miniprep on plasmid DNA extraction, then send it for sequencing.

my purpose is to sequence the gene out, then BLASTx it to see any similarities with others species.


so my questions are here:

1. how to ligate my insert DNA into vector?

2. how do i know which Restriction enzyme (R.E.) that i need to use to excise the vector and also my insert ? (how to check my insert DNA whether it contain any R.E site since i ont know the insert DNA before sequencing is done??)

3. i heard some people saying on adding a R.E site at 5' end on my PCR primer(reverse and forward) , is it feasible ?

Dear Edward,
If your purpose is for sequencing and dont know the sequence of the gene of interest, I suggest you use T/A cloning where you can avoid restriction mediated ligation. Taq DNA polyemarse enzyme adds a single, 3'-A overhang to each end of the PCR product. As a result, the PCR product can be directly cloned into a linearized cloning vector that have single base 3'-T overhangs on each end. Such vectors are called T- vectors.


If you still want to clone your gene using restriction mediated ligation, Then
1. Incorporate restriction sites to the 5' end of the Forward & Reverse gene specific primers,
2. PCR amplify the gene of interest, purify the product and digest the PCR amplicon with these restriction enzymes
3. Parallely digest the cloning vector with the same restriction enzymes
4. Ligate the digested PCR product and vector.
5,Transform, screen by blue white selection and /or colony PCR
6. Do plasmid prep, and give for sequencing.

NOTE :
You have to use restriction enzymes which have sites in the multiple cloning site (MCS) of the vector. Make sure that restriction enzymes you select do not have sites within the gene of interest. Else if u already know the sequence of the gene, You can use any online webcutter programs to search for presence of restriction sites.
If you dont know the sequence of the gene, you can do a digest of a little amount of your amplicon of interest with Enzymes in the MCS to check whether the gene is cut or not. And select the non cutting enzymes for cloning.

All the best

Regards
Avinash

http://aviprem.gq.nu

If not an expert in molecular protocols as sugested by aviprem is better to clone with sticky ends. Try a kit of TOPO TA cloning. And use the universal primers for the sequencing so you will have as much of the gene sequence as possible.

If you choose to go for TA cloning be sure that you do NOT use a proofreading PCR enzymes. Only the NON-proofreading enzymes will work properly.

When choosing to go for classic cloning using restriction enzymes I would recommend checking if they do not cut within your target sequence. This is my favorite tool to check: NEB cutter
If cloning of your DNA gives you a hard time you could go for outsourcing to gene synthesis companies like the one I work for: mrgene.com. It sometimes is cheaper than getting all the reagents listed in the posts above.

Thank you all for the advice, at least I have an idea on it now.
Anyway, I still have a puzzle to solve about primer, hope to hear from you again.

Ok, the situation goes this:

--------------->
5' AGTACTGTTGCAGAGATCCTATGCTGATC 3'
____________________ __ <-

................so: GCAGAGATCCTA is my gene of interest.

arrow head represent Forward and reverse primer, flanking the region.

so Question here is,

1. how do the polymerase will know when will it stop in order to give me the gene of interest ?

2. would it amplify region out of my interest as the following as Polymerase keeps adding nucleotides complimentary to template ?


--------------->CGTCTCTAGGAT(XXXXXX)
5' AGTACTGTTGCAGAGATCCTATGCTGATC 3'
_____(XXXXX)_______________<-

(XXXXX) is the part that maybe amplified along ?


please correct me if i am wrong. Thank you.

hi,

concerning how the polymerase knows when to stop i recommend to read some basics about the principle of PCR, then you will understand. the fact is, only the sequence from one to the other primer will be amplified exponentially.

to your cloning problem: i don't want to give you an advice what you should do, I just write what I would do in your situation

materials:

proofreading polymerase, I recommend Finnzyme's Phusion HotStart Polymerase (please note that there are special requirements for primer design if you want to use phusion, it is advisable to carefully read the manual of the enzyme before using it)
Fermentas Bacterial TransformAid Kit
Fermentas CloneJet Kit (includes everything like vector, T4 ligase, sequencing primers, buffers, control template, blunting enzyme)
E. coli strain for transformation like JM107 (if you ask it is provided with the cloning kit without extra charge)

and some other additional materials like agarose, DNA electrophoresis markers, PCR/gel purification kits, ingredients for LB-medium, ampicillin, Taq polymerase, restriction enzymes...

approach:
design primers spanning the whole gene of interest (GOI) without adding restriction sites
amplify with Phusion
use pcr product directly for ligation into the vector or gel purify if unspecific bands show up
transform bacteria with the ligation mix
streak on LB-amp plates
do colony PCR with the provided primers to screen for clones with the right insert length
inoculate O/N liquid cultures with the identified colonies
do plasmid miniprep, check by restriction digestion
send for sequencing

follow the instructions in the manuals and it will work, just one hint: it is not necessary to do 20µl of ligation mix. 10µl should also be sufficient. I often do transformations with only 2.5µl and it still works, so this can be scaled down. you can also ask for free sample kits so you can just try without spending money.
At the beginning I would also include the control template to control for transformation efficiency of the used cells. If it is ok. I would only include it further if problems arise.

Advantage: you don't have to hassle around with designing restriction sites along your primers, or with blue/white screening (b/c religated plasmid without insert will kill the cell).

If I don't have experience with making competent cells by my own, it is safer to prepare them with the TransformAid Kit (trial size also provided for free) which is quite "fool proof", again, this can be scaled down to half the volume which doubles the transformation reactions. however, it is a little more time consuming because you need a plate with single colonies before to start with the transformation.
And don't forget: you can get all the cloning and transformation reagents for free, you can also ask for a free Phusion sample.

Good luck!

I may have not read your queation carefully enough, but if you have a PCR product, why not skip cloning it, and sequence the gel-purified PCR product directly?

Agree with Homebrew sequencing your PCR product using your primers would be easier to start with.

Also you can use proof reading polymerases to do TA cloning, you just have to add the A after the polymerase reaction, any of the standard kits will have a protocol for this.

sequencing by using gel-purified PCR will save lots of works, but i'd been told that sometimes the sequencing result will have noisy background. so is there anyone to give comment on that pls ?

it depends on how clean your PCR product is. If there is only a single PCR product than you are find. If there are multiple PCR products, you can gel purify and excise your desired band for sequencing.