recommended primers for caspase 8 & 9 - human (May/19/2008 )

ello ello,
just wondering if anyone has some sequences (for real time) primers for the caspases 8 & 9.
I'm not having any luck, and google is not my friend today.

V

Hi V,
I don't have the sequences of known working primers for these two genes. So I tried designing some new primers for you. They should work.

CASP8 has mutliple isoforms and most of them share the same last 2 exons and 3' UTR. So I design the primers spaning the last 2 exons using primer3. The region from ~1800 to 2500 matches to multiple locations in the genome and should be avoid for primer design.
CASP8, Refseq:NM_001228
OLIGO start len tm gc% any 3' seq
LEFT PRIMER 1617 20 59.83 50.00 5.00 3.00 CATCCAGTCACTTTGCCAGA
RIGHT PRIMER 1744 20 59.80 45.00 4.00 0.00 GCATCTGTTTCCCCATGTTT
PRODUCT SIZE: 128

CASP9 also have at least two isoforms which share the same last two exons too. The following primers span the last two exons too.
CASP9,refseq: NM_032996
OLIGO start len tm gc% any 3' seq
LEFT PRIMER 687 20 59.94 45.00 4.00 1.00 12.00 TTCCCAGGTTTTGTTTCCTG
RIGHT PRIMER 829 20 60.11 45.00 5.00 1.00 10.00 CCTTTCACCGAAACAGCATT
PRODUCT SIZE: 143

Hope that helps.

I am completely dumbstruck at the effort you put into that pcrman. thankyou so much!!!
that was so awesome of you... just wow.
V

You'r welcome.