Protocol Online logo
Top : Forum Archives: : Real-Time PCR

recommended primers for caspase 8 & 9 - human (May/19/2008 )

ello ello,
just wondering if anyone has some sequences (for real time) primers for the caspases 8 & 9.
I'm not having any luck, and google is not my friend today.



Hi V,
I don't have the sequences of known working primers for these two genes. So I tried designing some new primers for you. They should work.

CASP8 has mutliple isoforms and most of them share the same last 2 exons and 3' UTR. So I design the primers spaning the last 2 exons using primer3. The region from ~1800 to 2500 matches to multiple locations in the genome and should be avoid for primer design.
CASP8, Refseq:NM_001228
OLIGO start len tm gc% any 3' seq
LEFT PRIMER 1617 20 59.83 50.00 5.00 3.00 CATCCAGTCACTTTGCCAGA
RIGHT PRIMER 1744 20 59.80 45.00 4.00 0.00 GCATCTGTTTCCCCATGTTT

CASP9 also have at least two isoforms which share the same last two exons too. The following primers span the last two exons too.
CASP9,refseq: NM_032996
OLIGO start len tm gc% any 3' seq
LEFT PRIMER 687 20 59.94 45.00 4.00 1.00 12.00 TTCCCAGGTTTTGTTTCCTG
RIGHT PRIMER 829 20 60.11 45.00 5.00 1.00 10.00 CCTTTCACCGAAACAGCATT

Hope that helps.


QUOTE (pcrman @ May 19 2008, 08:22 PM)
Hope that helps.

Hope that helps? I would pay for that! Great! smile.gif


I am completely dumbstruck at the effort you put into that pcrman. thankyou so much!!!
that was so awesome of you... just wow.


You'r welcome.