primer design from mRNA - (Mar/24/2008 )
Hi all,
I have to design qPCR primer...
if I use my target's mRNA to design primers, gDNA should not be amplified, right?
Thank you ![]()
Hi
I'm not sure I understand what you want to amplify. Is it cDNA (after RT reaction of RNA)? If so, whether your primers will amplify gDNA will depen on where you place them, for example if they are spanning introns that are large enough, only your cDNA will be amplified under conventional qPCR conditions due to the corresponding gDNA sequence being too long...
Hi,
yes, I want to amplify cDNA ( after RT ).
How can I design primers as you said? Do you know free programs to make it?
Thank you so much
Hi,
The Primer3 software is free and good for designing primers.
http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi
If you know where the exon boundaries are in your sequence, so can include these positions in the software (where it says targets), to design primers that include the junction and therefore avoid amplifying gDNA.
Hope this helps
The Primer3 software is free and good for designing primers.
http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi
If you know where the exon boundaries are in your sequence, so can include these positions in the software (where it says targets), to design primers that include the junction and therefore avoid amplifying gDNA.
Hope this helps
Hi, thank you for answer... and i have another question...
how I can do that? I mean by Pubmed I can see how much exon has my target... but i don't know how find the beginning and the end of exons...
thanks
CDS 1..2381
/locus_tag="TA08855"
/coded_by="complement(join(CR940353.1:1050117..1050353,
CR940353.1:1050448..1050629,CR940353.1:1050659..1050755,
CR940353.1:1050828..1052126,CR940353.1:1052156..1052360,
CR940353.1:1052391..1057516))"
I ve cut and paste an eg of a seq fr NCBI seq viewer. Regions of exons spliced together are often shown as
join (XXXX....XXXX+200), (YYY...YYYY+100) etc. At least thats what I understand. U might want to verify with someone.
Not sure if this suits your project but u might also want to consider the possibility of designing your primers at the 3'untranslated regions.
how I can do that? I mean by Pubmed I can see how much exon has my target... but i don't know how find the beginning and the end of exons...
thanks
It's better to use Ensembl to find exons. Find the gene you want, in the Transcript part select Exon Info to see all the exon and intron sequences or Transcript Info to see only transcript with marked exons. I use it all the time, it's better than to search it on NCBI.
Thanls a lot Trof, ensembl is more clear than NCBI!
so... for example... i'd like designing primers for rat Pnoc, i found my target in ensembl and i saw transcript info:
"This transcript 961 bp can be found on Chromosome 15 at location 44,822,640-44,835,640" right?
Now i have to load the genomic sequence in primer3 and include this region to design primer across introne-exone? Or I can load just a litte bite more from 5' gDNA interesting region? Or i can load only the transcript sequence?
![]()
Hi,
I would not use the genomic DNA but rather the cDNA/mRNA sequence to design the primers, Ensembl gives you the option of exporting that kind of data too. The way you identify the exon/exon junctions will depend on wether you have access to any sequence managment software (making it quicker) or if not, you will have to identify them manually from the information in ensembl.
Hope this helps
OK, a little workshop.
Basically you have to choose manualy which intron you want to span.
If you look at the exon info of Pnoc transcript, you see two introns.
(In fact it shows tree, but the middle one only 2bp long, which is most likely a mistake, since exons are sometimes only predicted in Ensembl = it's drawback. But checking with the NCBI reference sequence shows us only two exons as we thought, in fact there is discordance in the middle splicing site, NCBI claims peptide sequence "PVADEADEVE" and Ensembl "PVADADEVE" where E get lost in the artificial splicing and there is one missing nucleotide in the Ensembl DNA sequence as well, if you examine it.
Now, I'm not familiar with this protein to tell what is right and why the difference, but let's say we're gonna trust NCBI reference sequence in this case. I just add that usualy Ensembl and NCBI don't differ, so you don't have to solve a problem like these.)
Both of them are long enough to use (3kb and 8kb, polymerase won't cross that long introne) but only one of them (the first) is in the coding sequence, so let's choose the exon1-exon2 junction. Now when we know this, we just take first exon sequence from Ensembl Exon view, like this:
AGCCTGCTCTCCAGCGTGTTCAGCAGCTGTCCCGAGGACTGCCTCACCTGCCAGGAGAGG
CTCCACCCGGCTCCGGGCAGCTTCAACCTGAAG
and paste it to primer3.
Now we mark the last nucleotide with [] brackets, to indicate that this nukleotide/junction MUST be flanked by primers. (or you can choose to mark the first nukleotide of the next exon, it doesn't really matter)
When you do this, just copy and paste the second exon sequence, in this case more complicated, because we cannot use the Ensembl because the false splicing problem, so we find begining and the end of the second exon within NCBI reference sequence for Pnoc. Now we get this in the primer3 field:
AGCCTGCTCTCCAGCGTGTTCAGCAGCTGTCCCGAGGACTGCCTCACCTGCCAGGAGAGG
CTCCACCCGGCTCCGGGCAGCTTCAACCTGAA[G]
CTGTGCATCCTCCAGTGTGAAGAGAAGGTCTTCCCCCGCCCTCTCTGGACTCTTTGCACC
AAAGCCATGGCCAGTGACTCTGAGCAGCTCAGCCCTGCTGATCCAGAGCTCACGTCCGCTGCTCTTTACC
AGTCGAAAGCCTCGGAGATGCAGCACCTGAAGAGAATGCCGCGTGTCAGGAGTGTGGTGCAAGCCCGAGA
CGCAGAGCCTGAGGCAGATGCAGAGCCTGTCGCAGATGAGGCCGATGAGGTGGAGCAGAAGCAGCTGCAG
AAAAGGTTTGGGGGCTTCACTGGGGCCCGGAAGTCAGCCCGGAAGTTGGCCAACCAGAAGCGGTTCAGTG
AGTTTATGAGGCAGTACCTGGTCCTGAGCATGCAGTCAAGCCAACGCCGGCGCACTCTGCACCAGAATGG
TAATGTGTAGCCAGAAGGAGCCCCTCCCAGCTGCACCGGCCACTGCAACCCATGA
And you use this sequence to design primers you like.
Hope it helped.
PS: Usually it's much more easier, when you can just copy exons from Ensembl.