Please help me design BSP primer. - (Mar/23/2008 )

I have tried to design BSP primer by using Methprimer, Perlprimer and ABI Methyl primer express. Unfortunately, no appropriate primers are available. Is anyone here who could help design BSP primer? Thanks a lot in advance! The original and my targeted sequence are pasted below.

5'-TGTGTGCGAGTGTGTGCGCGCCGTGGCGCCGCCTCCGCCCGCCCCCAGCTCGGTCCCGCTTGCTCGCCGCGGCCGGGCGG
CCCTTTCGCGT
GTCCGCGCTGCCTCCCCTCCTCCTCCTCCTCCTCCTCCATTTTGCGAGCTCGAGTCTGTGACGGGAGCCCGAGTCACCGC
CCGCCCGTCGGGG
ACGGGTTCTCGTGGGTGGAAGGAGCCGCCGCGGCTGGAGCGGCTGGAGCGGCGGGGCGCCGGCAGCGAGGACGCGCGCCC
GGGAGCCCCGGCC
GGCGGAGCGGGGCGGGGGGCCGGCTTGTCAGCGGGGAAATGGGGGACTTTCTTCGCTAGGGGCCCTCCCCTCCCCCCATG
GAGAAGGGGGCGG
CTGTTTACTTCCTTTTTTTTTAAGAAAAAAAAAATCGCTCCCGCTCCTCCTGCTTTCACACGCTAAGTTGTTTATCTCGG
CTGCGGTGGGAGC
CGCGGACGGCGGCGGTGAGCGGCGCCGCGGGCAGAGCTGATACCCACTG-3'

You have CpGs everywhere in this sequence, it's hardly possible to design BSP primers.
Theoretically you can try to degenerate your primers - T fits every nucleotide so you can put T in a primer in a place where you are not sure of the nucleotide it will anneal to in DNA (so it will fit either methylated or non-meth sequence).
Anyway when I look at your sequence it seems that no oligos longer than 16-18 nt can be designed and i'm afraid it's much too short for genomic pcr. Maybe it's better to try msp..

Dear gangut, thanks for your reply! You mean it is unavoidable to include CpGs in the primer if I try to design BSP primer. To my knowledge, Y will be replaced in case that CpGs are present in the primer. Why is it T? What is more, annonations of my target sequence are unknown up to now. Hence which sites should be selected for my DNA methylation study? As you know, not every CpG site is very important for transcriptional regulation. I have to choose the regions which is supposed to affect transcriptional activity if I turn around to MSP.

you can always design primers that flank your sequence.

what does the sequence 500bp upstream and downstream look like?

Dear methylnick, upstream and downstream sequences of my target sequence is unknown yet. Could you design BSP primer according to the sequence attached?

How come it is unknown? If you blast your sequence with human genomic and get the coordinates, can't you extend the region of interest using for ex. map viewer by NCBI (click download sequence region).

as for the previous question: I don't know why it should be T. Sorry for such a stupid answer, but I actually forgot why T anneals to everything but it is a golden rule a colleague of mine uses why degenerating his primers and his primers always work well.

I also use T in my BSP primers if there's no way to skip CpG and such primers just work fine. Perhaps it doesn't have to be T, but if it works then i just do it like that.

I'll let you know when I find out why it is so.

putting a T in a place where methylation could occur (at CpG) is not ideal.

You would effectively be biasing your PCR toward unmethylated templates.

Always design degenerate nucleotides at these sites, youyuer you are correct to say it should be a Y.

Nick

Dear gangut & methylnick, thanks for your replies very much! Organism I research is pig, sequencing of whose whole genome is still in process. Therefore there is little knowledge about my target gene sequence.

Methylnick & gangut, could you do me a favor to design BSP primer based on the known sequence I pasted? I have tried, whereas no optimal primer was found by means of methprimer, perlprimer and ABI methyl primer express. I resort to two of you, as you are very good at it and have rich such experiences. Thanks a lot!

tony

Hi Tony,

I have had a quick look at your sequence, if you can get some more sequence 5' to it, that would be nice as I can not see any good sequences a primers.

There are a couple of sequences that can act as reverse primers.

I have mock-converted your sequence, all non-CpG's are bold T and all CpG's are highlighted.

Please look at the pinned topic about PCR and Primer notes for Bisulfite PCR

Good luck!

Nick

edit: inserted link

Dear nick, I have browsed the pinned topic. You said "There are a couple of sequences that can act as reverse primers.

I have mock-converted your sequence, all non-CpG's are bold T and all CpG's are highlighted." Where are they?

tony