who has done biotin pull down RNA interacting protein before? - biotin pull down RNA interacting protein (Jan/21/2008 )

who has done biotin pull down RNA interacting protein before?

I am familar and succeeded in cloing corresponding PCR fragments and western blot the related protein. but I am not familar with probe purification and using magnetic beads to pull down the protein.

Could you please tell me how long it will take me to get familar with it and get the result? is a month enough? Is the technique easy or difficult or Tricky?

I only have one month left in the lab.


Thanks



The technique was described below in a paper:


Synthesis of biotinylated transcripts and biotin pull-down assay. For in vitro synthesis of biotinylated transcripts, reverse-transcribed total RNA was used as template for PCRs using 5' oligonucleotides which contained the T7 RNA polymerase promoter sequence [(T7),CCAAGCTTCTAATACGACTCACTATAGGGAGA]. The sequences of all oligonucleotide pairs (forward and reverse, respectively) used to synthesize the DNA templates were as follows: (T7)AGAGAGTGGGGACGTCCGGC and TTACTCATTAGTAGCTTTTTTGAG for fragment CR, (T7)TAATTGGCCACTGCCTTATTT and GATGGCACTCACCATCTTTGTG for fragment a, (T7)CACAAAGATGGTGAGTGCCATC and TCTGTAAGATGTGAGAGGTGTTG for fragment b, (T7)CAACACCTCTCACATCTTACAGA and TTTTGCTCTGTGGTTTTCTTTTT for fragment c, and (T7)CCTCAACGACCACTTTGTCA and GGTTGAGCACAGGGTACTTTATT for glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The PCR-amplified products were resolved on agarose gels, and transcripts were purified and used as templates for the synthesis of the corresponding biotinylated RNAs using T7 RNA polymerase and biotin-CTP (45). Biotin pull-down assays were carried out as described elsewhere (45), except that the indicated quantities (2.5 to 20 nM) of recombinant glutathione S-transferase (GST)-TIA-1 and GST-HuR proteins (prepared and used as described in references 32 and 44, respectively) were incubated with a 5- to 50-fold molar excess of biotinylated transcripts for 30 min at room temperature. Complexes were isolated using streptavidin-conjugated Dynabeads (Dynal), and bound proteins in the pull-down material were analyzed by Western blotting using antibodies which recognized HuR or TIA-1 (below).

How big is the RNA size? There are reports of pulling down siRNA or miRNA interacting proteins using biotin-labeled RNA.

Hi Tulip1, I am trying to do a similar thing- see if protein directly interacts with RNA. So I am afraid I can't be of much help, but I have also seen some people using 'activated agarose beads to attach in vitro transcribed RNA: here is the reference: EMBO V 18 No 14 p4060-67 (1999). this seems possible. Could you tell me the citation of the technique you quote- I would like to read it carefully. thanks, good luck!

Thanks for PCRman and iloveagent57's reply.

my RNA is about 500, I PCR different fragments of the UTR of interest(they are all around 500), and cloned them into 10 constructs. I want to see which fragments can be bound by the protein of interest.