Unable to cut amplified fragments in promoter construct - (Jan/13/2008 )

Hi,

I m going to prepare various promoter deletion constructs.

I use primers with built-in Restriction enzyme cut sites to PCR amplify the fragment-->MluI and XhoI (underlined below)

AGACGCGTCAATACTTTTGCACAGTG (Forward)
AACTCGAGTGAAGTGTCCGTTGAG (Reverse)

However, the amplified fragment is difficult to cut using the above REs directly. Finally I use the pGEM-T-Easy to accomplish but is tedious.

I suspect is the orange colored 'heading bases' that is affecting. I'd like to know how do u design these 'heading bases' in the primers so that the amplified fragment can be cut directly. What is the optimal number of bases? Do u know any of those for MluI and XhoI?

Thx in advance.

In Molecular Cloning (Sambrook & Russel, 2001) they suggest 4 to 20 additional bases.

Additionally, some enzymes don't cut well at the end of linearized DNA. Have a look here. Both your enzymes are mentioned.

generally the rule of the thumb is to add 6bp of guard sequence ('heading bases'). This is generally sufficient for most restriction enzymes. Noted exceptions are NotI and NdeI, which require no less then 8bp.

If you have a look at the the link to NEB's website, you will find that MluI only cuts at 50% efficiency when spaced with only 2bp. I would guess that a problem lies there.

Thx, I have read the Molecular Biology Book and the website.

Now I know that the flanking bases at the termini of the PCR primers is important.

I have read a paper saying that 3 additional bases is enough.

However, I'd like to ask is any combination of the bases be ok?
E.g. CCG, GAC, ACG, TGC... both ok?

Thx

Hi,

I would put rather 6b extention as perneseblue said. When you design primers, the old-fashioned way is to look at the GC% (40-60%), calculate the approximate Tm ((number (A+T)x2) + (number (C+G)x4) (the Tm of primers should be similar), avoid T and runs of G and Cat the 3`end.

As you are planning to use MluI, be careful with this enzyme, as over digestion easily damages the ends and you will have trouble in ligation. We digest it for like 1hr and heat inactivate it. This helps in ligation.

Also give it 6 bases on the ends of the primer for digestion.