How to determine DNA sequence is from male or female? - (Dec/28/2007 )
The following is a sample sequence, by using BLAST I got that this sequence is for Human clotting factor 8. How can we determine that this sample sequence is from normal male, normal female, afflicted male, afflicted female or a carrier?
"GAAGTGCACTCAATATTCCTCGAAGGTCACACATTTCTTGTGAGGACCAT"
"GAAGTGCACTCAATATTCCTCGAAGGTCACACATTTCTTGTGAGGACCAT"
In this case, it sounds like you are being asked to learn how to use NCBI's tools. You have learned how to blast a sequence. If you repeat your blast, you will see that each hit is hotlinked to additional information. Follow the link. The information you will see, often includes a journal title etc, to help you figure out the answer.
In other words, this question sounds suspiciously like an assignment - and one that I might have given my own students. Follow the link attached to the best blast hit, see if you can dig around for the answer from the journal article and stuff like that - let me know how you do.
HTH,
Patty
ps more generally speaking, there are tags that discriminate male from female, sometimes, but I don't *think* you could see such a tag on a 50 base nucleotide text sequence.
"GAAGTGCACTCAATATTCCTCGAAGGTCACACATTTCTTGTGAGGACCAT"
In this case, it sounds like you are being asked to learn how to use NCBI's tools. You have learned how to blast a sequence. If you repeat your blast, you will see that each hit is hotlinked to additional information. Follow the link. The information you will see, often includes a journal title etc, to help you figure out the answer.
In other words, this question sounds suspiciously like an assignment - and one that I might have given my own students. Follow the link attached to the best blast hit, see if you can dig around for the answer from the journal article and stuff like that - let me know how you do.
HTH,
Patty
ps more generally speaking, there are tags that discriminate male from female, sometimes, but I don't *think* you could see such a tag on a 50 base nucleotide text sequence.
True, This is an assignment meant to get familiar with BLAST but I couldn't figure out how we can get a clue that the sequence is from a male or female, etc.?
I'm lost. Did you follow the link for the best blast hit? The link will take you to additional information associated with the sequence, including journal titles that should correspond to the methods used to collect the DNA to begin with.
I don't really understand the assignment - perhaps you are meant to make an educated guess based on the disorder that the gene is associated with. It does look like your instructor wants you to apply a little reasoning.... but I have no real idea.
Follow the link from the BLAST results page, scan through the info given there, and see if anything starts to click.
do you have any other information (like it is from an adult patient)? what else do you know about this condition? on which chromosome do you find the gene?
if it is from an adult patient and comes out abnormal (from the blast result) and it is a condition that females don't survive into adulthood (it is for blood clotting factor) then you can say that it is from an afflicted male.
In response to your pm, I'm afraid I can't help much further. Does your instructor have office hours?