Primer design - Issues with GAPDH primer blast search (Nov/20/2007 )
Hi,
I am in the process of designing a bunch of primers for my work on rat brain. I think I've finally got my head around the basic process but I am a little confused about my BLAST search results (I am probably being very stupid but I've never done this before and people in my lab don't appear to be sure either!). Using primer 3 I have come up with a several primers for GAPDH (genbank ref NM_017008) but when I put them into BLAST they all come up with lots of highly significant results like this: "PREDICTED: Rattus norvegicus similar to glyceraldehyde-3-phosphate dehydrogenase......" and often the best result is for this: " Rattus norvegicus BAC CH230-145N21 () complete sequence...". When I put in some published sequences they too generate the first result so I'm wondering if this one is not a problem (perhaps as it's only predicted??!!) but I presume the second one is something completely different and I don't want primers that recognise this?
If anyone could let me know where I'm going wrong I would me most grateful! I have attached screen shot of the results for this sequence of mine (BLAST shot1) CCTTCATTGACCTCAACTAC and this published sequence CCCCCAATGTATCCGTTGTG (BLAST shot2) as I think my explanation above is a little rubbish!
Cheers,
H
<snip>
H
Hi Hellie,
I personally wouldn't worry (not sure about others though). It looks as though your primers match GAPDH and considering GAPDH is a widely used house-keeping gene I am not surprised that you get a zillion hits when you blast your primers!!! Not sure if this helps but thought I'd put my 2 cents in instead of reading papers this late in the afternoon
Clare
Hi Clare,
Cheers for your input, I was kind of thinking that was probably the thing to do but I get paranoid about these things! Glad to provide you with some distraction from your papers!
Helen