shrna NRGβ1a type III (AF194438) - (Oct/16/2007 )

Hi

I was searching for a good iRNA sequence against NRGβ1a type III (AF194438) and I found it in RNAi Library of Cold Spring Harbor Laboratory, (5’TGGTATTTGTGGACAAGATATTCAAGAGATATCTTGTCCACAAATAC CTTTTTTC 3’
5’TCGAGAAAAAAGGTATTTGTGGACAAGATATCTCTTGAATATCTTGTC CACAAATACCA 3’)
We plan to transfer the whole sequence into PLL3.7 plasmid by insert them between HpaI and XhoI. But we can not confirm it will give us a higher efficiency. We can apply it directly, or makes some candidates and do a lot of testing ?


Thank you very much for your help in advance

i think you may consider the fact it's validated in a publication or not.
If you plan to test many possibilities, i would ask a company to design siRNA against your gene (eurogentec did pretty nice for me) and directly order oligos to clone the 3 candidates in plasmids. Generally you can expect 80% silencing.