What is the proper upper limit of false priming in real time? - (Sep/24/2007 )

I usually use OLIGO 6 and primer premier 5 to design primers for real time PCR. But I often found that there were many differences in the analysis parameters between these two softwares. For example , I design primers for GLUT4. I found a primer pair suitable for real time PCR in the OLIGO 6, but not good in the false priming efficiency in the primer premier 5.

This pair is :
5' GGCTCTGACGATGGGGAA 3'
5' TCTGTGGGGCATTGATAACC 3'

I upload several pictures of the false priming efficiency. Hope someone to give me some advices.

the upper primer false priming efficiency in primer premier 6 and OLIGO 6

the lower primer in the primer premier 5 and oligo 6

OK, my reply is a bit OT... but from my POV, predictions are not very reliable, so I prefer to spend my time trying them on a pcr instead of checking their quality on multiple softwares... you'd be surprise to see the number of primer pairs with a perfect prediction score that were completely rubbish in practice and the opposite...