PCR troubles - PCR works one day but not the next (Aug/30/2007 )

Hi there,
I've been having problems with my PCR reaction for a while, and any help will be more than appreciated.
I'm trying to amplify b-actin and GAPDH from gDNA, which should not be too hard, and in fact isn't as I have managed to do it a few times. The problem is my PCR reaction works one day, but not the next. I can't even reamplify the purified products (well, again I could once, but not the next day).
I've tried all the usual stuff: fresh primers, fresh dNTPs, fresh Taq and buffers, fresh DNA. different Temps, different MgCl conc..... I then change suppliers and again it worked once but could not repeat it. The DNA seems to be fine by gel (have different preps). I have now send the thermocycler for servicing as it was playing up, but when trying the machine they've send me on loan... guess.... yeah, it did not work.
I'm now going to try different additives.

Any suggestions and comments will be more than welcome, as I have never had such a temperamental PCR that just works whenever it feels like it.

cheers!!!!

Unless you are satisfied with rumors and generalities, you'll have to tell us exactly what you are doing. Some things I would say without knowing anything are that you might be seeing inhibition from template impurities. Try diluting the template 10x and 100x. Try lowering the extension temperature, especially if you have low GC templates (64C and extend the time). Your water quality may be bad. Are you using a hot lid or oil to prevent evaporation?

here's the protocol i'm using; having optimized (ie the one that does work when it works).

200uM dNTP mix
1.5mM MgCl2
100pM each primer
100-200ng gDNA (is this too high?) I tried diluting my gDNA 1:10 and 1:100, and got no band. times i got it work i used 1ul (which according to my abs calculations is ~ 200ng).

94C for 10min
40 cycles:
94C 30sec
55C 30sec
72C 30sec

final extension 72C 10min.

I've tried gradient PCR twice, between 45C and 65C I got product at every temperature.

I stuck with the program above because it seems fairly standard and it works beautifully when it does.

today i'm trying same reaction adding either 5%DMSO, 0.1% Tween20, or 1.5% Formamide.

i dont understand what's going on. I've had problems in the past with funny PCRs, but never one that only worked sometimes once it has been optimised.

other problem is i don't actually have a positive control. I used a mycoplasma detection kit to check the thermocycler and it did work, and so did my PCR that time.

oh, and I'm using Invitrogen's Ultra Pure DNAse/RNAse free water, and a heated lid.

So I am thinking your template concentration is way too high... here are some calculations I was doing today with another researcher...

Celera estimates 6.6pg gDNA per cell which is 3.3pg gDNA per gene copy (assuming only two copies) so for each ng of gDNA you have 303.3 copies of a normal gene. Now with GAPDH and actin there are many pseudogenes for each of these so lets assume for 10 pseudogenes per real gene copy that means you have about 3000 copies of gap or b-actin template in 1 ng of gDNA and for 200ng gDNA you would have 600,000 copies of template. In addition you are adding 0.9967ng of non-template gDNA per ng of gDNA added to the reaction in other words 199.34ng of gDNA that is not your template and may interfere with your primers finding the appropriate template. To me this may be the whole problem... I believe this is way too much... Lower your template concentration and then optimize your primers to work with that... Another good trick is to take a PCR product that worked and dilute it (at least 1000 fold) and then use that as the template to optimize your primers, because this template will be less complex it may help with optimizations...(ie: in the case of purified PCR product 100% of the DNA added is template rather than 0.33% as with gDNA(not counting pseudogenes))

Overall I think you may be seeing inhibition of the reaction because there is too much template present.

Hope This Helps
and
Good Luck!

How long is your product? What is the enzyme you are using? Buffer? What is the organism? Can you show us the primer sequences?

And finally what is the volume of all the reactants you are adding?
Not to long ago, a person with a similar problem approached the forum. The problem turned out to be an imprecise pipette that was unable to dispense accurately small volumes. Have your pipettes been calibrated recently?

thank you !

I'm using Invitrogen's Taq with the buffers provided, and invitrogen's dNTP mix.
the organism is mouse, i extracted the DNA from SP2 cells.
I usually do 20-50ul reactions, but prepare a master mix so volumes are not that small. Pipettes are quite accurate and I don't think that's the problem, thou i would check with other lab members when was the last time pipettes were calibrated.

We are a very small company with limited resources, things like trying a different machine, or asking the lab next door for some reagents are not possible

Finally the primers: I have 3 different sets for each gene (which could also be combined). the last set of each of them are the primers i used during my PhD as controls for real time PCR (and they always worked with cDNA). I designed all primers using Primer3, Tm are 59-60C for all of them.

GAPDH-594/2900_f acccagaagactgtggatgg
GAPDH-1093/3593_r cttgctcagtgtccttgctg

GAPDH-436_f: ttgtgatgggtgtgaaccac
GAPDH-1232_r: gtgggtgcagcgaactttat

GAPDH-183/2257_f: ttccagtatgactccactcacgg
GAPDH-564/2736_r: gcccttccacaatgccaaag

b-actin-699/2299_f: aaatcgtgcgtgacatcaaa
b-actin-1145/2965_r: acatctgctggaaggtggac

b-actin-1940_f: ttgcactccttgcatgtctc
b-actin-2745_r : gtgctaggagccagagcagt

b-actin-885/2580_f: tggaatcctgtggcatccatgaaac
b-actin-1233/3053_r: taaaacgcagctcagtaacagtccg


Thanks again

Are you having trouble with all of these primers? I gather the numbers refer to positions on the genes. If so, then you appear to be trying to amplify 400 and 800 bp fragments, roughly. The 400 bp ones should be ok with your extension time, but the 800 bp fragments could probably use a 1 minute extension time rather than the 30 seconds you are allowing. If you are on the edge with respect to this, it could easily explain the inconsistencies you are seeing. Are you having troubles with all of the primer pairs? Do some reactions work during a run and others not, or do all fail and work together?

I have had very good luck using premixed PCR reaction mixes, which eliminates a lot of the potential problems. I use the Invitrogen PCR Supermix High Fidelity, a mix of Pfu and Taq which seems to just work most times. I don't fiddle with Mg++ concentrations. I almost always use 55C annealing. I sometimes need to do low temperature extensions, but you probably don't have to worry about that in mouse. My favorite high GC addition is 3-7% betaine rather than DMSO or glycerol.