2kb PCR - Help!!!!!!!!!! (Jun/20/2007 )
Hi, I've been trying to amplified a 1900bp fragment from gDNA but so far got no results!!
It's the promoter region of a human gene, I designed primers (25bp long with restriction enzymes sites) and made PCR of gDNA from HeLa and Mia Paca cells.
The conditions were as follows:
50ul mix:
H2O 26.7ul
Buffer 5x 10ul
dNTPs 1x 1ul
Taq 0,3ul
Pr Fw 10uM 5ul
Pr Rv 10uM 5ul
gDNA (0,14ug/ul) 2ul
Cycle:
94ºC 2'
94ºC 30'' *
59ºC 30'' * *40 cycles
72ºC 2' 30'' *
72ºC 5'
With this, the controls were fine but didn't amplified the promoter so....
I did it again adding 5% glycerol to the mix...........controls OK! but no promoter
Then I tried changing to a two step PCR
94ºC 2'
94ºC 30'' *
68ºC 2' 30'' * *40 cycles
72ºC 5'
...in this case I tested
- the standard mix
- adding DMSO 5% to the mix
- adding BSA 0,1mg/ml
Again the controls were just fine but the promoter didn't amplified..
Primers are
Fw: 5’CCCGTCGACCACCCCAGGCTGGACA 3’ Tm (from manufacturer) 72ºC
Rv: 5’GGGTCTAGACCCCAGATCCGCAATG 3’ Tm (from manufacturer) 68ºC
enzymes sites are highlighted
I guess that as the ER sites don't anneal with the template, the Tm actually is lower, right?
What else can I do to improved my PCR experiments?
Taq is supposed to work well for amplifications till 5kb!!!!! so it has to amplified my fragment!!
Anybody? any help? please!!!
hope to get a reply
biotech
Assuming your + control works fine, I'm guessing your Master Mix has no problems. For the dNTPs, is that a mistype of 1x? For the primers, half that amount will also work too. 2.5ul of each 10uM primer. Taq, I would do 0.5ul, doesn't seem too accurate to pipet that low unless you're trying to save reagents/money.
one way to check primer annealing temperature is to do a temp gradient PCR. A real-time machine or a thermal cycler that allows a temperature gradient across the block helps a lot. Otherwise it's just pain staking and might not be worth it. In addition, you need a good amount of template to do it too. So make sure you have some to spare.
Doing this will allow you to pick a good temperature for your annealing. It looks like 59 would of been a good temp. If you want to do a virtual check, try going to http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi, put in the sequence of the template (if you don't have it, try ncbi) and put in the primer sequence WITHOUT the restriction enzyme sites. Then whatever temp they give you, i've found that 3-5 degrees higher than the lowest primer temp usually works for me.
Also, sometimes too much glycerol in a PCR may not be too good for the PCR.
In general, the way I do PCR with the elongation step is 1 min for every 1000bp I want amplified.
Also, what is your + control. To check your template, you can try a dloop + control. This amplies a portion of the mitochondria DNA in your sample. This helps to verify is you have any DNA in there. Sometimes pipetting too much or thaw and freezing too much will degrade/break the DNA template and make it useless in for PCR.
Hope you get it to work.
While Taq can and has amplified fragment 4kb in lenght, this is neither easy nor even desirable. With Taq, it starts becoming hard going after about 1.5kb. I wouldn't amplify anything more then 1kb with Taq. The optimisation hassel is just too much.
But more importantly, Taq makes a lot of mistakes. The error rate of taq is given to be somewhere between 1x10^-4 and 2x10^-5 per basepair. For those who are looking for percentage polymerase error rate equation, I have written it below;
P(Good) = [1- (error rate*product lenght bp)]^ number of cycles
Assuming the lowest error rate for Taq, product lenght of 1900bp and 25 cycles, only 38% of the PCR product will be error free. If the higher value is used, the value drops to 5%. Thus I would strongly suggest, using a proof reading enzyme like KODhifi or Vent. The product yields are better and the error rate far lower.
You are correct. The melting temperature currently in use is far too high. I believe the manufacturer is quoting the tm for the entire primer. I have recalculated the tm for only the template binding segment of the primers.
Fw: 5’CCCGTCGACCACCCCAGGCTGGACA 3’ Tm 56
Rv: 5’GGGTCTAGACCCCAGATCCGCAATG 3’ Tm 53
The melting temperature you should use is about 48 celsius too 50 Celsius.. I would try 49 Celsius first.
You don't need and should not run 40 cycles. The PCR reaction plataeus at around 30 to 35 cycles. You don't get any more product after that. As you are cloning a gene, I would keep the number of cycle numbers to around 25. The more cycles present, the higher the percentage of mutant molecules that are produced. When you have the reaction working, compensate the lower yeilds by increasing the number of tube being run. Do not increase the volume of the reaction mix.
You need to redesign your primers, I just blasted them and the specific region (only 16bp - way to short) has more than 20,000 hits in the genome, while with your RE site added there are only 2,000 hits there don't appear to be any with the specific region you have as a 100% match - the reverse primer is better, only 220 hits (must be in the gene
) and assuming you are amplifying BCL2 inhibitor of transcription isoform b this primer should be okay (still more misprime sites that bind exactly to the 3' end but because of low number of these hits will probably still work okay)
you have to blast primers especially when working with complex template like genomic DNA... it is hard sometimes to find specific primers in the promoter region as consensus TFBS are often found throughout the genome. You definately need more than 16bp for specificity... Blast both specific primer and primer with RE site added to be sure no mispriming sites (focus on mismatch of at least 1 (better 2-3+) at the 3' end of the primer) Good luck!
Thank you all for the information,
- I know Taq is not the best, but as we already have some sample of it I started with that....
- About dNTPs.....which concentration is right?
- As for the control....is a 600bp fragment of the actin gene.
- I didn't checked the primers for other annealing sites in the genome, I didn't knew that, thanks!
- The gene is VMP1 (also called Tmem49) is a stress induced gene..
well, I'll check this info and tried again,
thanks.
- I know Taq is not the best, but as we already have some sample of it I started with that....
- About dNTPs.....which concentration is right?
- As for the control....is a 600bp fragment of the actin gene.
- I didn't checked the primers for other annealing sites in the genome, I didn't knew that, thanks! ;)
- The gene is VMP1 (also called Tmem49) is a stress induced gene..
well, I'll check this info and tried again,
thanks.
I think that you should redesign your primers. I just tried a PrimerSelect for them and the second one forms bad hairpin.
I USED "primer3" TO DESIGN THE PRIMERS
IS THERE A BETTER ONE?
ME AGAIN!
TO BUY A NEW ENZYME, WHICH IS THE BEST CHOICE.......
If I buy a new one, I want something I could used for many experiments - I'm studying a promoter so after the main amplification, I will probably generate smaller fragments to test activity - so I would buy one that works fine for the whole process.
which one is the best choice of the market?
thank you
I take it you mean polymerase?
The "best" polymerase depends on the lenght that is being amplified. Polymerases that can make really long products usually have lower yeilds.
So, in the region of 1kb - 5kkb, my favourite is KODhifi from Novagen. High yeilds, low error rate and relatively 'cheap' for the quantity of enzyme your money gets you.
KOD long template and Phusion are my lab's perferred polymerase for products 7kb and up.
EDIT:
For primer design , try to aim for your primers (actually the segment that binds to the template) to have a melting temperature of 60 celsius. A primer of this lenght often has few secondary binding sites. Primer 3 produces a bunch of candidate primers. Use Blast to eliminate primers which are not so good. I use Northwestern oligo calculator to calculate tm, and double check for hairpin structures.
The "best" polymerase depends on the lenght that is being amplified. Polymerases that can make really long products usually have lower yeilds.
So, in the region of 1kb - 5kkb, my favourite is KODhifi from Novagen. High yeilds, low error rate and relatively 'cheap' for the quantity of enzyme your money gets you.
KOD long template and Phusion are my lab's perferred polymerase for products 7kb and up.
EDIT:
For primer design , try to aim for your primers (actually the segment that binds to the template) to have a melting temperature of 60 celsius. A primer of this lenght often has few secondary binding sites. Primer 3 produces a bunch of candidate primers. Use Blast to eliminate primers which are not so good. I use Northwestern oligo calculator to calculate tm, and double check for hairpin structures.
thanks for the advice!