kozak sequence has to be in frame? - (Jun/07/2007 )

Hi all, i had some problems with one construct that i've been doing, i am trying to clone one transcription factor into a eukaryotic vector (pEYFPN1), after some work, i have my construct, so i transfected it into 293 T cells, and i found that the distribution pattern of this construct does not look like should be, seems that is the fluorescent protein alone (YFP), so i get worried and i look again on the primers that i used for the ampification of this trasncription factor, and i found that the Kozak sequence that my PI gave me on the primer is not in frame with the ATG start codon, is that a problem, or the Kozak sequence does not affect the ATG start codon???? This is the Forward primer that i used, has a Bgl II site:

5’ GCATCCAGATCTCGCCACCATGCCAAGCACCAGCTTT 3’

some one can help me and tell me if this primer is wrong or not!!!!!!!!!!!!!!!!!!!!!!!!


THANK YOU!!!!!!!!!

Consensus sequence for Kozak sequence is as below
(gcc)gcc(A/G)ccAUGG

Primer
5’ GCATCC AGATCT C GCCACCATG CCAAGCACCAGCTTT 3’

Most of the Kozak sequence is present. The ribosome works by scaning along the mRNA transcript looking for good ATG sites to bind. So there isn't the question of in frame or not, rather is the sequence good enough to pause the ribosome complex so that it initiate translation.

I would say the kozak sequnece is okay. Although that doesn't rule out problems with expression, eg the promoter might be acting up. Or the gene product itself is causing problems.

What coul happen if i get rid of the kozak sequence???

Without the kozak sequence, the translation efficiency of the protein will drop. How badly I have no idea. The promoter is a factor here. Ie if you have a lot of mRNA about, it could compensate for reduce amount of translation.

What actually is the problem. Could you explaine a little more. Is the YFP not expressing? Or is it going to the wrong place? Do you have the right localisation singal tagged onto the YFP.

Are you expressing only YFP or is it a fusion construct ?

The Kozak sequence in the primer seems fine except for the presence of a G after the ATG. It shouldnt matter so much.

Having Kozak highly increases the possibility of decent expression.

The influence of different context in Kozak sequence can to be read in this paper.

Nucleic Acids Research, 2004, Vol. 32, No. 4
5´Untranslated regions with multiple upstream AUG
codons can support low-level translation via leaky
scanning and reinitiation
Xue-Qing Wang and Joseph A. Rothnagel*


the A from ATG is +1
This is a extract of paper

"The strength of the AUG context sequences ranged
from `strong' to `weak' and in descending order were A-3 + G+4
> G-3+G+4 > A-3+A+4 > G-3+A+4 > U-3+G+4 > U-3+A+4"

I am sorry I cannot upload this paper

bye,

The construct is a fusion between YFP and my transcription factor, and when i do the transfection in 293 T cells i saw a very low!!!!!!!!! expresion, in one dish of 35 mm i only can find 4-5 cell with fluorescence (my control that is only YFP has a 90 % of transfection efficiency), and is very weak, this transcription factor (Nfatc1) should be on the cytoplasm of the cells and after an increase of Ca2 + it should move to the nucleus, but the only thing that i can see is fluorescence all over the cell (weak fluorescence) and i thought that the primer thas has the kozak sequence and inmediately the ATG is not in frame.... but you said the primer looks good so i don't know...

thank you for the paper, i am going to read it

but the question is, "Is both segments of the fusion gene in frame?"
Or perhaps the fusion with YFP is causing problems with folding of the transcription factor, have you tried both N terminal and C terminal fusion? Sometimes a long linker sequence helps.. a random loop spacer sequence between the two proteins.
Do you know which bits of your transcription factor is the working end?

the C termianl of my transcription factor is in frame with the ATG of the YFP.

How a long linker can help???