Two Tm peak in real-time but only one product on a gel? - What's goning on????? (May/30/2007 )
I used real-time to amplify a number of genes. Mostly worked fine but one was really wierd. In the real-time PCR, it showed 2 Tm peaks with about 4oC difference. After the real-time PCR, I ran the PCR product on a gel but only one band was observed. So, what happened and why? (melt and gel pic attached)
(The gene was NM_206963; F-primer was ggcgcttcacttcttcaact; R-primer was tctgggttgtagcgctctgt)
It may be a polymorphism, an alternatively spliced transcript or a nonspecific product just the same size with your specific amplicon. Are you sure it's a single band?
I had a similar problem with the melting curves of a product. I ran it on a 2% gel until everything is separated well. Then I saw two very close bands. I first suspected that I caught an alternate transcript because I was working on a different tissue, so I purified both the bands and had the products sequenced. Finally, one of the fragments turned out to be a nonspecific product just 20 - 30 bp shorter than my specific amplicon. My primers didn't match with that gene on BLAST, so I wasn't expecting it.
Sometimes happens 
I had a similar problem with the melting curves of a product. I ran it on a 2% gel until everything is separated well. Then I saw two very close bands. I first suspected that I caught an alternate transcript because I was working on a different tissue, so I purified both the bands and had the products sequenced. Finally, one of the fragments turned out to be a nonspecific product just 20 - 30 bp shorter than my specific amplicon. My primers didn't match with that gene on BLAST, so I wasn't expecting it.
Sometimes happens
Thanks for your suggestion. But the gel I showed you in the attachment is a 2.5% gel. So I would thought if only 1 band on that gel, that might be really one single band.
By the way, can you remember what's the Tm difference when you saw your two peaks in your melting curve you described? Is it less than 4oC or more than 4oC?
By the way, can you remember what's the Tm difference when you saw your two peaks in your melting curve you described? Is it less than 4oC or more than 4oC?
The difference was something like 4.5 C, more or less.
I would definitley sequence the product to check it isn't a polymorphism. I use RT-PCR to screen for polymorphisms in my gene of interest and I get 2 melt curves when there is even only one NT change - this would obviously only show up as one product on an agarose gel whatever the concentration.