Protocol Online logo
Top : Forum Archives: : Molecular Biology

T7 promoter sequence - some help please (Mar/28/2007 )

Hi everybody!!!

I wonder if somebody could help me find the T7 promoter sequence.

Thanks a lot!!!


5’ TAATACGACTCACTATAGGGAGA 3’ Transcription starts with GGGAGA (highest product yields if the first 6 nucs are GGGAGA).




Thanks a lot!!!!!!!