Can some one help me with some Molecular Biology questions? - molecular biology questions (Oct/16/2006 )
I would say for a linear DNA you have 157 fragments. (156+1; round down 156.25)
-perneseblue-
4 base cutter implies it will cut every 2^4 bases which is 16.
Since the strand is 40,000bp, it 'll cut 40,000/16 which is 2500!!!
as for the codon question Leu is coded by 4 codons
Met is coded by 1 codon
Lys is coded by 2 codons
so the combination is 4 X 1X 2=8
-ruchi-
5' -- ATGATACCGACGTACGGCATTTAATACTATGGCTGCATGCCGTAAATT --3'
antisense :
3'-- TACTATGGCTGCATGCCGTAAATTATGATACCGACGTACGGCATTTAA--5'
QUOTE (ruchi @ Dec 22 2006, 10:50 PM)
4 base cutter implies it will cut every 2^4 bases which is 16.
Since the strand is 40,000bp, it 'll cut 40,000/16 which is 2500!!!
Since the strand is 40,000bp, it 'll cut 40,000/16 which is 2500!!!
why 2?
let me explain it to you,
you have 4 bases , each base have the probability of 1/4 since we assume base distribution is random
so, for a tetrcutter, a recognition sequence of 4 bases must be found
so,
(1/4) x (1/4) x (1/4) x (1/4)= (1/4)^4 =1/256
so the enzyme will cut at each 256 nucleotides
40,000/256= 156,25+1=157
-strawberry-