Can some one help me with some Molecular Biology questions? - molecular biology questions (Oct/16/2006 )
Hello, i am studying Molecular Biology and i am seeking help with a few fundemental concepts in Molecular Biology. My Friends have suggested the Bioforum because this is a good community of people interested in Molecular Biology. Any help you can provide is greatly appreciated.
1] The first concept is, ok lets say i have a sequence "TAATCGAATGGGC"
How would i go about deriving different protein sequences from that sequence? Are protein sequences 3 bases in length? Can you help me derive 3 protein sequences from that sequence?
2] if i have a gene and the direction of transcription like this,
--------------------->
5' -- ATGATACCGACGTACGGCATTTAATACTATGGCTGCATGCCGTAAATT --3'
How can i find the sequence of the corresponding antisense strand and the mRNA?
Also, how can i fidn the sequence of the resulting protein?
3] If i have a protein sequence LMK (L= leucine, M= methionine, K= Lysine) how many dna sequences could give rise to it?
4] How would i show a digestion sequence for the restriction enzymes BamH1 and HindIII. What would the "Sticky ends" look like?
5] If i have a DNA molecule of length 40,000bp and digest it with a 4-base cutter restriciton enzyme (the enzyme recognizes a 4bp sequence). Assuming a random distribution of bases in the DNA molecule, statistically, how many pieces/fragments can we get when the DNA molecule is digested with the restriction enzyme?
this is the quesitons i have, any responses is much appreciated.
1] The first concept is, ok lets say i have a sequence "TAATCGAATGGGC"
How would i go about deriving different protein sequences from that sequence? Are protein sequences 3 bases in length? Can you help me derive 3 protein sequences from that sequence?
2] if i have a gene and the direction of transcription like this,
--------------------->
5' -- ATGATACCGACGTACGGCATTTAATACTATGGCTGCATGCCGTAAATT --3'
How can i find the sequence of the corresponding antisense strand and the mRNA?
Also, how can i fidn the sequence of the resulting protein?
3] If i have a protein sequence LMK (L= leucine, M= methionine, K= Lysine) how many dna sequences could give rise to it?
4] How would i show a digestion sequence for the restriction enzymes BamH1 and HindIII. What would the "Sticky ends" look like?
5] If i have a DNA molecule of length 40,000bp and digest it with a 4-base cutter restriciton enzyme (the enzyme recognizes a 4bp sequence). Assuming a random distribution of bases in the DNA molecule, statistically, how many pieces/fragments can we get when the DNA molecule is digested with the restriction enzyme?
this is the quesitons i have, any responses is much appreciated.
1. Yes, you want to convert 3 bases into an amino acid that corresponds to it. But first you need to convert the above DNA sequence into mRNA (convert T->A, A->U, C->G, G->C). You can find a table online or I would guess there is one in your book, usually inside the front or back cover, that will have all of the amino acids and their bases. Remember that there are also a few groups of 3 bases that mean "stop" and "start". I think there's just an extra base in your sequence above, or you typed it wrong.
2. Just as in #1, to find the antisense strain, you go 3' to 5' and convert T->A, A->T, G->C, C->G. Then to find mRNA, you convert just as in #1. Then group them by 3's and convert to amino acids.
3. For most amino acids there are multiple mRNA codons that give rise to them. e.g. Threonine is either one of ACU, ACC, ACA, or ACG. So then you have to work backward and convert those letters to DNA sequence. You should make a big table so it is organized.
4. I'm not quite sure about 4 or 5.
dima,
Firstly this isn't the part of the forum to ask homework questions.
Secondly would it really help you if somebody answered the questions for you? Have you even taken the time to even try to answer your homework?
Jeepers, these questions are basic text book question. Apply some effort to them. Look up a molecular biology book for question 1 and 2. Use Google for question 3, the NEB website for question 4. And question 5 isn't even a molecular biology question, it is a maths question.
There will come a day, nobody can help you because nobody knows the answer. You'll have to find the answer on your own. It is best to start practising now. It would have been better if you had answered those question first and pasted question and answers here and asked everyone if it were right.
Hello, i am studying Molecular Biology and i am seeking help with a few fundemental concepts in Molecular Biology. My Friends have suggested the Bioforum because this is a good community of people interested in Molecular Biology. Any help you can provide is greatly appreciated.
1] The first concept is, ok lets say i have a sequence "TAATCGAATGGGC"
How would i go about deriving different protein sequences from that sequence? Are protein sequences 3 bases in length? Can you help me derive 3 protein sequences from that sequence?
2] if i have a gene and the direction of transcription like this,
--------------------->
5' -- ATGATACCGACGTACGGCATTTAATACTATGGCTGCATGCCGTAAATT --3'
How can i find the sequence of the corresponding antisense strand and the mRNA?
Also, how can i fidn the sequence of the resulting protein?
3] If i have a protein sequence LMK (L= leucine, M= methionine, K= Lysine) how many dna sequences could give rise to it?
4] How would i show a digestion sequence for the restriction enzymes BamH1 and HindIII. What would the "Sticky ends" look like?
5] If i have a DNA molecule of length 40,000bp and digest it with a 4-base cutter restriciton enzyme (the enzyme recognizes a 4bp sequence). Assuming a random distribution of bases in the DNA molecule, statistically, how many pieces/fragments can we get when the DNA molecule is digested with the restriction enzyme?
this is the quesitons i have, any responses is much appreciated.
1. Yes, you want to convert 3 bases into an amino acid that corresponds to it. But first you need to convert the above DNA sequence into mRNA (convert T->A, A->U, C->G, G->C). You can find a table online or I would guess there is one in your book, usually inside the front or back cover, that will have all of the amino acids and their bases. Remember that there are also a few groups of 3 bases that mean "stop" and "start". I think there's just an extra base in your sequence above, or you typed it wrong.
2. Just as in #1, to find the antisense strain, you go 3' to 5' and convert T->A, A->T, G->C, C->G. Then to find mRNA, you convert just as in #1. Then group them by 3's and convert to amino acids.
3. For most amino acids there are multiple mRNA codons that give rise to them. e.g. Threonine is either one of ACU, ACC, ACA, or ACG. So then you have to work backward and convert those letters to DNA sequence. You should make a big table so it is organized.
4. I'm not quite sure about 4 or 5.
WAstate, thank you for your reply. for 4. you wrote about 4 or 5..did you mean this for question #5?
i think quesiton 5, the answe is 1000..because if we have 40,000bp and the enzyme cuts 4bp, won't we have 1000 fragments? i did 40,000 / 4 = 1000.
also for quesiton #1 i checked it, the sequence does have an extra base..TAATCGAATGGGC
pernesblue, thank you for the response, i tried solving them..just still confused..for quesiton 5 i think the answer is 1000,
for question 4 i think its
BamH1: 5'---G GATCC---3'
3'---CCTAG G---5'
cuts between GG bases
HindIII: 5'---A AGCTT---3'
3'---TTCGA A---5'
Cuts between AA bases
do you guys think quesitons 4,5 are correct?
Better.
The answer to Q4 is correct.
However the answer to Q5, including the reasoning used to obtain that answer is wrong. As a task, explain what a 4bp restriction enzyme is.
Pernesblue, thank you for pointing out my answer to #5 is wrong, so i'm kind of stuck here hmm, so a restriction enzyme will cut the sequence in specific points i know that, so 4bp Restriciton enzyme will cut it every 4 bp right? so if there are 40,000 bp, isn't is 40,000 / 4 = 1000 pieces? Please help me out
for 5 is it 1/4 to the fourth power times 40,000
1/256 * 40,000 ?
1/256 * 40,000 ?
That will give you the number of cut site.
Now that is the number of cut sites however look at this
For a linear molecule
1 cut site = 2 fagments
2 cut site = 3 fragments
so number of fragement for a linear molecule is ((1/256) * 40000) + 1
But for a circular molecule
1 cut site = 1 fragment
2 cut site = 2 fragments
so number of fragement for a linear molecule is (1/256) * 40000)
Draw this out to prove it to yourself.
As you have no doubt realised, a 4bp restriction enzyme does not cut at any 4bp but recognises a specific motif of 4bps. eg will only cut when ATAT occurs. It will not cut at any other place. Probability of any specific sequence appearing is (1/4)^n
1/4 as there are 4 types of nucleotides
i completely understand now thank you, but 1/256 * 40,000 = 156.25
so would my answer be 156 pieces and 1 frament ?
a total off 157..
or do i round off to 156?