Inserting tag into the vector. - where is IRES? (Sep/10/2006 )
Hello again
i want to try to insert EGFP into the vector containing my cDNA, rather than inserting my cDNA into EGFP vector, cause later is not working at all
. so i read through some posts. i should consider something like IRES and polyA signal right? i can see polyA on the vector map, but where do I find IRES? i know it is 12 AUGs.....no such sequence visible here
anything else i should take care of, thanx a lot!
Hi.
Not familiar with IRES consensus sequence, but the one from encephalomyocarditis virus (ECMV) is
.......aaaaacacgatgataat atg nnnnn
---------consensus-------- start--coding
which is the same as being used in pIRES2-EGFP Vector (Clontech). Refer http://nar.oxfordjournals.org/cgi/content/full/27/6/1552
there r dif. IRES sequences (dif. sizes as well) depending on their origin. some companies do sell plasmids with IRES sequence (tried and tested).
Take care while trying to clone something like IRES. It can b tricky.
also hope it works.
at the same time, y dont u build a second cassette in ur vector, might b useful.
thank you very much for your replies.
Scolix, sorry a little different but related question: if for example i want to insert my protein before the tag into the MCS and my insert will have the stop codon, then for EGFP to be succesufully translated there should be IRES sequence in between my insert and the EGFP and polyA signal to be after EGFP, right? . how do I check for that? am I mixing up everything? ![]()
IRES sequences usually are indicated in the map vector provided by the company. You can check for them!
u r right abt the order of the different parts of the plasmid.
One usually has a vector map and then plan everything according to the vector map and finally one could sequence it just to b sure. ( does this answer ur question).
inorder to have an idea abt how things should b in a vector with IRES, look for a IRES containing plasmid (from any company) and go thru the map. this will help.
you may paste the sequence in the plasmapper online tool.
well i'm not ko with all your exp, but think that if you want to clone before the tag and you iset holds the stop codon, you won't have a tagged protein.
After your insert, you should have IRES - EGFP - stop - polyA signal.
thanx a lot everyone!
Fred, thank you for the link, but it seems any sequence i paste it just gives me error all the time ![]()
maybe it's from your server that you have the error.
If you want, pm me the sequence of your vector and i'll try to make the research for you.
Alternatively here is the assumed ires sequence of my vector
CGCCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTG
ATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGG
TCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACA
AACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGT
ATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTC
CTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCAC
ATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAAC
ACGATGATAAGCTTGCCACA
Fred, thank so much. i am considering something else right now. as this method doesnt seem to be too simple and we have such a short time
. however, if im back to thinking about it, it would be very helpful if you can identify my vector for me. it is strange since i used three different computers here in the lab and all of them gave me errors... ![]()