Primer for 5' RACE - (Jun/07/2006 )

hallo,

i've some questions concerning 5' RACE PCR, especially creating the primer using for the initial RT-reaction.
in a normal RT-reaction i use oligodT primer for amplifying cDNA from mRNA, cause the oligodT primes the polyA-tail.
for the 5' RACE it is recommended to do the RT-reaction with a gene specific primer. so i have to create a primer against my mRNA of interest, so that only cDNA of my gene is amplified?
right so far?

and how to do that? someone can give me an example?




gDNA: aggtagtcgatcgactgctatggatctcgat

mRNA: uccaucagcuagcugacgauaccuagagcua

primer: ?

no one any idea?

Hi,

we use the SMART™ RACE cDNA Amplification Kit from Clontech to do the RACE PCRs (see attachment).
There, you use a 5`-CDS primer for the cDNA synthesis which is provided with the kit.
In the following RACE PCR (amplification of your desired product) you use a gene-specific primer. The specifications are: 23-28 nt, GC content = 50 - 70 %, high Tm. It has to be an antisense primer, so if your DNA sequence is:


gDNA: 5` aggtagtcgatcgactgctatggatctcgat 3`

you could chose this primer f.ex.: 5` atcgagatccatagcagtcgatcgac 3`.

It binds to the complementary strand of you DNA.