Stem loop RT-PCR for miRNA quantification - how can I design the stem loop primer? (May/10/2006 )

I have read a paper (Caifu Chen, Nucleic Acids Research, 2005, Vol. 33, No. 20 e179)
reporting that using stem loop primer (as is shown in the attach .jpg file.)
in RT-PCR of the small RNA is more efficient than using linear one.

However, there isn't any description about how to design the stem loop primer in that paper.

Is there any method, book, paper, or software?

Is there somebody who could help me out on this problem?
Thank you very much.

you will find example primer sequence in following paper
Nucleic Acids Res. 2006 Jan 24;34(2):e9

Here is an example

Stem-loop RT primer for miR10a

GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACcacaaa

In the RT primer, only the last 6 nt are unique to miR-10a, and will bind to the 3' end (green) of miR-10a. The rest (44-nt) of it will form stem-loop structure. The purpose of stem-loop is to increase melting temperature. You can use the same sequence for many miRNAs, but the last 6 nt must be specific to the miRNA you want to detect.

>hsa-miR-10a 5'- UACCCUGUAGAUCCGAAUUUGUG -3'