Cutting close to DNA ends - (May/01/2006 )
Hi everyone,
I know that some enzymes will not cut if they are too close to the ends of DNA fragments.
I want to cut pcDNA3.1(+) with HindIII and Kpn I
The sequence in the plasmid where they occur is 5' TTAAGCTTGGTACCGAGCTC 3'
The underlined part is HindIII and the italized part is KpnI. They are right next to each other.
If I cut with HindIII first and generate a 4 base overhang, will KpnI then be able to cut? The NEB website says KpnI cuts 99% when there is 1 base pair from the end but this would be 0 base pairs I guess?
Thanks!
E-star
hi
what you can do for checking your both digestis to cut by kpnI, pick an aliquot, digest the rest with hindIII. Then, do a transformation test with same amount of dessalted plasmid. You'll see if the "double digest" gives more colonies than the simple one. if colony number is roughly equivalent, that's because plasmid is not totally digested. in that case you'll have to pcr the plasmid and cut the resulting product.
I transformed my double digested plasmid and didn't get any colonies which must be a good sign?
I figure if only one enzyme was cutting then the plasmid would re-anneal to itself and I would see colonies. But since I didn't see any colonies, is it safe to say both enzymes cut?
E-star
hi
it's a good news. You're can not be 100%sure that ALL molecules are double digested, but it seems a good point for your exp
Hi.
I always understood that the reason you dephosphorylate your vector is precisely because you can never guarantee 100% digestion.
Why not try a CIP treatment after your digestions. You should only see transformants from successful ligations (but, Murphy's Law being what it is, you may find a few colonies where neither RE cut...rare, but possible...)
RE: your transformation expt with digested plasmid. Did you also transform uncut plasmid to see if your cells are OK? A really dull control, but really important. (Isn't it always the way?)
Good luck
Whatever your status is, just my 2 cents, HindIII is not good enzyme to cut at the ends so I would cut with HindIII first and then KpnI,
Do post what did you do and how it worked.
Hi All
Ok, so I cut pcDNA3.1(+) with HindIII first then with Kpn I.
I did do the positive control - uncut plasmid - and saw loads of colonies so know the cells and the transformation step is OK.
Did a negative control using my plasmid cut with HindIII and KpnI and saw less than 5 colonies so I think it's mostly cutting. Plus, I saw some colonies with my ligation reaction so think it worked.
I think my problem was that originally I was cutting with KpnI first so HindIII was then obviously not cutting.
Thanks all! I love this bioforum site!