reverse primer design with restriction site - (Apr/20/2006 )

hi

i am very new to this cloning and expression. i have designed my forward primer with restriction enzyme site in the 5' end and i took care such that they are similar to the sense strand.
can anyone tell me the method to design a reverse primer for my sequence using restriction enzyme site at 5' end. is it neccessary to design the restriction enzyme site also complementary to the sense strand?

please guide me........

thanking you
serat

well, the principles will be the same, except that you need to use the reverse complement sequence to base your primers on...did you mean you want to design the 3' primer?

If the site is palindromic, it looks the same -- for example, GGATCC reversed and complemented is GGATCC...

well, your answer lies in Homebrew's reply


and yeah, it needs to be the reverse complement of the RE recognition sequence, too; if it's palindromic it's the same sequence, as HB said; if not it's the rev compl

do you see?

I can give you an example if you are still confused, but I think you'll get it if you mess around with your sequence a little

EcoRI:

5--->3

GAATTC
CTTAAG

3<----5

BamHI:

5 ---> 3

GGATCC
CCTAGG

3<----5

etc.

All the major restriction enzymes are palindromic.

Here's an example of some primers I recently designed:

5 - BamHI Mis

GGCC[GGATCC] atgttttgtacattttttgaaaaac

3 - EcoRI Mis

GGCC[GAATTC] CTATTCTTTTTTCTCCTTC

---

GGCC provides additional nucleotides for cleaving purposes: restriction enzymes do not like cutting at the very end of sequences, in general.

Sites in brackets are the restriction sites engineered into the primers.

The rest of the sequence is the gene to be amplified.

-Matt

thanks Matt for the wonderful example. it was very helpful.
now i am very clear with the concept and i have finished designing the primer....

serat