how to determin the Annealing Temp of ristriction sites modified primer? - help me ! (Mar/23/2006 )
hi
are u trying to introduce the restriction site only to the 5 'end?
if ur trying to design forward primer and reverse primer for pcr with restriction sites at each end ,
then after designing the primers
enter them in this site
http://trishul.sci.gu.edu.au/tools/OligoCalculator.html
and see if the temperature of both the primers are same
lenght , try to keep it atleast 25
then order the primers
and while doing pcr take the annealing temperature as the one u got from the site
hope it is clear and is what u asked for
all the best
Hi phytoviridae:
Thanks for your reply!
I enter my primers in http://trishul.sci.gu.edu.au/tools/OligoCa...ml,Consequently, I got the Tm value. But unfortunately, It is different from the Tm value given by Oligo6.22. Tm value given by This site is 63c degree, and the Tm value given by Oligo is 80c degree, the former is much lower than the later. which should I accept?
I can get the Tm value of both primers completely complementary to the Template, and ristriction sites modefied primers. Annealing Temp can be roughly estimated by the Tm value.namely, Annealing Temp used in PCR= Tm +/-5c degree. now problem appeared, which Tm here should be used, Tm of oligos completely complementary to the Template, or Tm of the modefied primers?
hi
take the tm from the oligo site for annealing temp
and take mgcl2 variations from 1.5mM to 4.5 mM
keep the temperature same ,,.. i dont understand why the temp is different for template and all that
try if this works , it usually did for me when i am using primers that modify the ends
i order primers from bioneer and i take the annealing temp same as shown in the oligocalculator tm
till now it worked
all the best
for example
my primers CPNI and CPNII
have tm = 60
i take four tubes with varying concentration of MgCl2
after making the reaction mix and spinning down and adding mineral oil ,
set the pcr cycles like this
95 Degree Cel -2 min - 1 cycle
94 Degree Cel -1 min }
60 Degree Cel-2 min } - 35 cycles
72 Degree Cel -3 min }
72 Degree Cel- 7 Min - 1 cycle
hope its not confusing
Hi, aimikins and phytoviridae:
Thanks for your reply, your suggestion is much appreciated!
I will try to find an optimal Annealing Temp.
This has gotten much too complicated, IMHO. We do PCR with primers containing 5' RE sites routinely (once or twice a week for years now) and pay not the least bit of attention to such worries..
It's true that there are many ways to calculate Tm, but as long as you always do it the same way, your primers will all behave consistently. For example, we pick all our primers using Primer3, and shoot for about a 24-mer (min 20, max 30, not including the 5' addition) with a 60°C Tm. We'll usually run the PCR with an annealing temp of 52°C - 58°C, using Invitrogen's PCR supermix. To us, it really doesn't matter what the Tm actually is -- we know that if Primer3 says it's 60°C, then the primer will behave a certain way, and work best with a 52°C - 58°C annealing temp. Primers selected this way also work well with samples submitted to our sequencing core facility, which assumes a Tm of 60°C -- of thousands of sequencing reactions we've done, none have ever failed due to the primer...
When using the primers (with or without a 5' addition), we'll usually start with a 55°C annealing temp, and adjust that up or down by a couple of degrees if needed (in the vast majority of cases, no adjustment is needed -- the first reaction works fine).
We have found no need to adjust anything specifically to account for the presence of 5' additions (usually a six-base RE site and 2-4 irrelevant bases). This is likely due to the fact that the primers are going to melt off at 95°C, and re-anneal at some point as the temperature drops from 95°C to 55°C. There is, in our hands, no need to account for the 5' addition when using these primers -- we even use the same protocol to screen subsequent clones (using, for example, a vector-borne forward primer and the original reverse primer). In that case, presumably all the template has the 6-base RE site, yet the reverse primer works fine in the standard 55°C annealing temp assay.
My guess is that as long as your primer anneals (with or without 5' modification) somewhere between your highest (melting) temp (95°C) and your lowest (annealing) temp (say 55°C), and will not melt off at your extension temp (72°C, sometimes 68°C), you're fine.
It's true that there are many ways to calculate Tm, but as long as you always do it the same way, your primers will all behave consistently. For example, we pick all our primers using Primer3, and shoot for about a 24-mer (min 20, max 30, not including the 5' addition) with a 60°C Tm. We'll usually run the PCR with an annealing temp of 52°C - 58°C, using Invitrogen's PCR supermix. To us, it really doesn't matter what the Tm actually is -- we know that if Primer3 says it's 60°C, then the primer will behave a certain way, and work best with a 52°C - 58°C annealing temp. Primers selected this way also work well with samples submitted to our sequencing core facility, which assumes a Tm of 60°C -- of thousands of sequencing reactions we've done, none have ever failed due to the primer...
When using the primers (with or without a 5' addition), we'll usually start with a 55°C annealing temp, and adjust that up or down by a couple of degrees if needed (in the vast majority of cases, no adjustment is needed -- the first reaction works fine).
We have found no need to adjust anything specifically to account for the presence of 5' additions (usually a six-base RE site and 2-4 irrelevant bases). This is likely due to the fact that the primers are going to melt off at 95°C, and re-anneal at some point as the temperature drops from 95°C to 55°C. There is, in our hands, no need to account for the 5' addition when using these primers -- we even use the same protocol to screen subsequent clones (using, for example, a vector-borne forward primer and the original reverse primer). In that case, presumably all the template has the 6-base RE site, yet the reverse primer works fine in the standard 55°C annealing temp assay.
My guess is that as long as your primer anneals (with or without 5' modification) somewhere between your highest (melting) temp (95°C) and your lowest (annealing) temp (say 55°C), and will not melt off at your extension temp (72°C, sometimes 68°C), you're fine.
Hi, HomeBrew:
Thanks for your opinion. And Your experience is rather valuable to me.
In your opinion, the primer with or without 5‘addition could anneal at a lower Temp (usu.55°C)?
we have no need to take the 5‘addition into account? what is the specificity of your PCR product?
By the way, Usually, how many and what bases do you add on the5’ end of XhoI sites?
Many thanks!
Best Regards!
Yours
Albert.
I have done hundreds of PCRs using primers with restriction sites or dummy sequences at the end and I have had almost 100% success rate with them. The most reliable and easiest way of determining Tm is as follows: Use only the sequences that are complementary to your template. Disregard the sequences that are dummy or do not match, then use the following formula:
Tm = 2(A+T) +4(G+C)
I have never had a PCR not work because of incorrect Tms calculated by this formula. The biggest variable, if at all, that I find is MgCl2 concentration. Adding a little bit extra (1ul of 25-50 mM to a 50 ul reaction to make it around 250 mM if using Invitrogen SuperMix) almost always helps and does not hurt.
Good luck.
Torpi ![]()
Thanks for your opinion. And Your experience is rather valuable to me.
In your opinion, the primer with or without 5‘addition could anneal at a lower Temp (usu.55°C)?
we have no need to take the 5‘addition into account? what is the specificity of your PCR product?
By the way, Usually, how many and what bases do you add on the5’ end of XhoI sites?
Many thanks!
Best Regards!
Yours
Albert.
Look at it this way: If you take the homologous bases of the unmodified primer as baseline, then adding bases to the 5' end is just going to make the Tm higher, right? So if the unmodified primer would work well at a 55°C annealing temp, then the modified primer will as well, 'cause its annealing temp will only be higher; somewhere between 95°C and 55°C. So, by the time the temp gets down to 55°C, the primers are all annealed.
The problem with selecting an annealing temp is not that the primer's true annealing temp might be higher, but problems arise if you select too low and annealing temp, 'cause then you have spurious binding. As long as everything melts at your highest temp, and your lowest temp is correct with regards to the homologous bases of the pre-modified primer, then everything starts melted and ends annealed.
With regards to 5' irrelevant bases, we follow the recommendations on NEB's web site (see here). For anything routine, I usually stick four bases on (though we used to do two without difficulty). Also, just as a matter of convenience, I usually use the reverse of the last four bases of the primer, just because it adds the property of discouraging the primer from folding up on itself (I have no empirical evidence that this actually occurs, mind you, but since I've got to pick four irrelevant bases anyhow, this just makes it easy and standardized). So, if my primer is taataaatttccacacacgcagac, and I wanted to add a XhoI site to it, I would order:
cagactcgagtaataaatttccacacacgcagac
BTW, my primer picking program (see here) calculates the Tm of this 24-mer as 60.29°C.
Hi Torpi and HomeBrew:
Thanks for your sharing your valuable experience.
HomeBrew, If you add restriction sites on the 5' end of the primers, Could you tell me how to check the modified primers through the primers? Or you at all diregard the dummy sequence?
Best Regards
Yours
Albert
I'm not sure what you're asking...
If you're asking if I check the primers before use, the answer is no. If I'm cloning the PCR product, I'll run the reaction, check ~10% on a gel, clean up the rest with Qiagen's PCR clean-up kit, digest the cleaned PCR product, run it on a gel, excise the digested band, recover the DNA with Qiagen's Gel Extraction kit, and combine it with appropriately digested vector in a ligation reaction.
We do this so often, we've pretty much optimized every step to minimize labor and increase the chances of success. We use Invitrogen's Hi Fidelity PCR Supermix, so there's minimal pipetting, no fooling with MgCl2, etc. The PCR clean-up kit is very fast, as is the gel extraction kit. We use Amhersham's Ready-to-Go T4 DNA ligase for the ligation. Gel purifying the digested PCR product is essential.
Say I start on a Monday -- I'd usually start the PCR reaction Monday before leaving the lab, plate my ligation mix before leaving the lab Tuesday, and have colonies by Wednesday morning.
Could you tell me how to check the modified primers through the primers? Or you at all diregard the dummy sequence?
I'm not sure what you're asking...
If you're asking if I check the primers before use, the answer is no. If I'm cloning the PCR product, I'll run the reaction, check ~10% on a gel, clean up the rest with Qiagen's PCR clean-up kit, digest the cleaned PCR product, run it on a gel, excise the digested band, recover the DNA with Qiagen's Gel Extraction kit, and combine it with appropriately digested vector in a ligation reaction.
We do this so often, we've pretty much optimized every step to minimize labor and increase the chances of success. We use Invitrogen's Hi Fidelity PCR Supermix, so there's minimal pipetting, no fooling with MgCl2, etc. The PCR clean-up kit is very fast, as is the gel extraction kit. We use Amhersham's Ready-to-Go T4 DNA ligase for the ligation. Gel purifying the digested PCR product is essential.
Say I start on a Monday -- I'd usually start the PCR reaction Monday before leaving the lab, plate my ligation mix before leaving the lab Tuesday, and have colonies by Wednesday morning.
Hi HomeBrew:
Thanks for your reply!
I am so sorry that I dis not describe the problem clearly. I mean that When you add Restriction sites on the 5‘ end of the primers selected by primers, then you order the modefied primers immediately ? Do you check the modefied primers through the Primer3?
Thanks