RT-PCR Control Reactions - Need suggestions! - (Mar/03/2006 )

Hi there,

I am performing conventional RT-PCR (not real time) and I've been using GAPDH as a control reaction (to be compared to the levels of my transcript of interest). However, for one particular gene that is significantly less abundant than GAPDH, I'm finding that it is an inappropriate control for multiplex reactions. Can anyone suggest another gene and perhaps even give primer information for a gene that you've used for RT-PCR as a control that is significantly less abundant than GAPDH, that seems to work well?

Greatly appreciated,

kfk78

Try 18S rRNA

Here are two pairs of primers I use and they are designed based on the sequence X03205:

18S rRNA
18S-F1 1025 20 60.37 50.00 3.00 0.00 11.00 tcaagaacgaaagtcggagg
18S-R1 1513 20 58.52 50.00 3.00 1.00 11.00 ggacatctaagggcatcaca
PRODUCT SIZE: 489

18S-F2 1577 20 60.84 50.00 5.00 1.00 gtaacccgttgaaccccatt
18S-R2 1727 20 60.48 55.00 5.00 5.00 ccatccaatcggtagtagcg
PRODUCT SIZE: 151