PRIMER design - primer dimers (Nov/28/2005 )

hi BIOFORUM buddies,m
can any one tell me y primers gets dimerized during the PCR reaction. the lenth of forward and backword primers is about 21 each, and also how this dimerisation could bavoided. what care has to b taken during the design of a primer pair.

If primers dimerise it means they stick together rather than to the DNA. If you've got two primers eg AGGTTAACTCCGAGCCAGTCA and AGTTCCACCACGGTCCTGACT then the two ends AGTCA and TCAGT can dimerise and you will get a wierd 40 base band in your DNA.
You can avoid primer dimers by taking great care over your primer design, I took a week to design four primers once, but they worked perfectly!