vivo expression technology - ivet (Jul/22/2009 )
fishdoc on Jul 24 2009, 08:45 PM said:
lucilius on Jul 24 2009, 11:21 AM said:
I was indeed talking about ds dna at the start, but when it enters the bacterium it becomes ss dna and then you have homologous recombination with ds dna and ss dna...
and thats where I am getting confused since homologous recombination is always explained with 2 ds dna pieces.
I understand that the with a double crossover only a piece of the plasmid is integrated, but you state that by single crossover the entire plasmid wille be integrated in the genome, isnt it possible that a little part of the plasmids dna isnt integrated?
PS. it is with double crossover that the mutation is tranferred, but there is absolutly no way how you can direct this, so its possible that the mutation isnt transferred at all then?
You do not know wich piece is tranferred....
and thats where I am getting confused since homologous recombination is always explained with 2 ds dna pieces.
I understand that the with a double crossover only a piece of the plasmid is integrated, but you state that by single crossover the entire plasmid wille be integrated in the genome, isnt it possible that a little part of the plasmids dna isnt integrated?
PS. it is with double crossover that the mutation is tranferred, but there is absolutly no way how you can direct this, so its possible that the mutation isnt transferred at all then?
You do not know wich piece is tranferred....
I'm not familiar with how ssDNA recombines with dsDNA. I'm sure there are enzymes involved, but I can't explain the mechanism. It may be similar to, or the same as when dsDNA recombines. I don't know.
For your second question, for a single crossover event, the whole plasmid integrates. At least that's how I've always known it to occur. I don't see how a piece of the plasmid wouldn't integrate during a single crossover event.
For you last question, there is most definitely a way to direct homologous recombination... by using homologous sequences.
For a short example, say your gene sequence is:
AGTCTGCGATAGCAGAGTCCCCTGAAAGTGACTACGAGGG
and you want to remove the string of 4 Cs in the middle. You make a construct that is AGTCTGCGATAGCAGAGT-TGAAAGTGACTACGAGGG (where the (-) is the deletion). That sequence flanking the deletion will direct where recombination occurs. Recombination will only occur in areas where there is homologous DNA present.
However, if you're talking about transposons, phage, or other types of DNA, they can insert into non-homologous regions, but for the scope of what we're talking about here, the sequence flanking the mutation will direct where the recombination occurs.
For us, we need at least 500 bp on either side of a mutation for efficient recombination to occur. Sometimes up to 1 kb is needed. However, there are strains of E. coli (I think) and Salmonella (for sure) that have a lambda red phage that allows for recombination to occur with as few as 40 bp or so of flanking sequence.
Again, I don't know how all this translates to ssDNA recombining, but this is basically how it works for dsDNA, either linear or in a plasmid, recombining with genomic.
Ok, you have: AGTCTGCGATAGCAGAGTCCCCTGAAAGTGACTACGAGGG , but want to get rid of the 4c's, you make this: AGTCTGCGATAGCAGAGT-TGAAAGTGACTACGAGGG
Is this AGTCTGCGATAGCAGAGT-TGAAAGTGACTACGAGGG then lineair dna or circular? And the - (the deletion) is this then an opening in that dna sequence or is are the 2 T's attached to eachother? (wich seems strange.)
Or is there still a "hole" between those 2 T's and does the recombination starts at both sides of that "hole" one recombination going to the right (TGAAAGTGACTACGAGGG ==>, starting at the T) and the other one going to the left (AGTCTGCGATAGCAGAGT , starting at the T and goinh <==== like this)
I'm not familiar with how ssDNA recombines with dsDNA. I'm sure there are enzymes involved, but I can't explain the mechanism. It may be similar to, or the same as when dsDNA recombines. I don't know.
I'll have to look into this then, because its this proces I really need to understand.
For your second question, for a single crossover event, the whole plasmid integrates. At least that's how I've always known it to occur. I don't see how a piece of the plasmid wouldn't integrate during a single crossover event.
Eum, single cross over, you do mean single point crossover then? like in this image:
-lucilius-
lucilius on Jul 24 2009, 02:05 PM said:
Ok, you have: AGTCTGCGATAGCAGAGTCCCCTGAAAGTGACTACGAGGG , but want to get rid of the 4c's, you make this: AGTCTGCGATAGCAGAGT-TGAAAGTGACTACGAGGG
Is this AGTCTGCGATAGCAGAGT-TGAAAGTGACTACGAGGG then lineair dna or circular? And the - (the deletion) is this then an opening in that dna sequence or is are the 2 T's attached to eachother? (wich seems strange.)
Or is there still a "hole" between those 2 T's and does the recombination starts at both sides of that "hole" one recombination going to the right (TGAAAGTGACTACGAGGG ==>, starting at the T) and the other one going to the left (AGTCTGCGATAGCAGAGT , starting at the T and goinh <==== like this)
Is this AGTCTGCGATAGCAGAGT-TGAAAGTGACTACGAGGG then lineair dna or circular? And the - (the deletion) is this then an opening in that dna sequence or is are the 2 T's attached to eachother? (wich seems strange.)
Or is there still a "hole" between those 2 T's and does the recombination starts at both sides of that "hole" one recombination going to the right (TGAAAGTGACTACGAGGG ==>, starting at the T) and the other one going to the left (AGTCTGCGATAGCAGAGT , starting at the T and goinh <==== like this)
It can be either linear or circular. In my case, it has to be in a plasmid, but as I said earlier, some bacteria can accept linear DNA by electroporation.
The 2 Ts are attached to each other. It's a deletion mutant, so you delete a portion of the gene. Alternatively, a resistance marker could be put in there leading to it looking like this: AGTCTGCGATAGCAGAGT(kanamycin)TGAAAGTGACTACGAGGG
As far as the recombination, the crossover ideally occurs on each side of the mutation, leading to a double crossover event and allelic exchange. If a single crossover event occurs, and the construct is of plasmid origin, the single crossover results in integration of the plasmid.
There can't be a hole between the bases, I just put the (-) there to denote where the deletion occurred.
Eum, single cross over, you do mean single point crossover then? like in this image: 

This site will explain much of what I'm talking about, but with images. http://www.sci.sdsu.edu/~smaloy/MicrobialG...ec-genetic.html
http://www.sci.sdsu.edu/~smaloy/MicrobialG...e-exchange.html
-fishdoc-
fishdoc on Jul 24 2009, 09:50 PM said:
It can be either linear or circular. In my case, it has to be in a plasmid, but as I said earlier, some bacteria can accept linear DNA by electroporation.
The 2 Ts are attached to each other. It's a deletion mutant, so you delete a portion of the gene. Alternatively, a resistance marker could be put in there leading to it looking like this: AGTCTGCGATAGCAGAGT(kanamycin)TGAAAGTGACTACGAGGG
As far as the recombination, the crossover ideally occurs on each side of the mutation, leading to a double crossover event and allelic exchange. If a single crossover event occurs, and the construct is of plasmid origin, the single crossover results in integration of the plasmid.
There can't be a hole between the bases, I just put the (-) there to denote where the deletion occurred.
The 2 Ts are attached to each other. It's a deletion mutant, so you delete a portion of the gene. Alternatively, a resistance marker could be put in there leading to it looking like this: AGTCTGCGATAGCAGAGT(kanamycin)TGAAAGTGACTACGAGGG
As far as the recombination, the crossover ideally occurs on each side of the mutation, leading to a double crossover event and allelic exchange. If a single crossover event occurs, and the construct is of plasmid origin, the single crossover results in integration of the plasmid.
There can't be a hole between the bases, I just put the (-) there to denote where the deletion occurred.
Eum I see, I'll have to look into it to fully understand it.
basically, if I am understanding it correct, you kinda "swap" the gene that you want to delete with what you put between the 2 pieces you have next to the deletion (or knamycin)
==> AGTCTGCGATAGCAGAGT(kanamycin)TGAAAGTGACTACGAGGG and you use this to swap the kanamycin with the 4 c's , right?
This I understand, but when you have a deletion it seems strange to me that AGTCTGCGATAGCAGAGT-TGAAAGTGACTACGAGGG will attach itself to the AGTCTGCGATAGCAGAGTCCCCTGAAAGTGACTACGAGGG dna piece, since you have those 4 cccc's extra in the middle or is it that the (by example) right part TGAAAGTGACTACGAGGG (from the one you created with the deletion) will be attached to the TGAAAGTGACTACGAGGG part of the original and then start the recombination, ending with the final part (the left part of the created piece of dna) AGTCTGCGATAGCAGAGT and this ending with that last T , meaning that those 4 CCCC's in the middle will not be replicated and thus be lost.
or is this a wrong view?
I'll check those websites.
Damn its hard to undertand all this when you never had any real molecular biology.
If I would have know this would be all part of my thesis
I am a chemistry major in polymers lol
-lucilius-
lucilius on Jul 25 2009, 10:40 AM said:
basically, if I am understanding it correct, you kinda "swap" the gene that you want to delete with what you put between the 2 pieces you have next to the deletion (or knamycin)
==> AGTCTGCGATAGCAGAGT(kanamycin)TGAAAGTGACTACGAGGG and you use this to swap the kanamycin with the 4 c's , right?
This I understand, but when you have a deletion it seems strange to me that AGTCTGCGATAGCAGAGT-TGAAAGTGACTACGAGGG will attach itself to the AGTCTGCGATAGCAGAGTCCCCTGAAAGTGACTACGAGGG dna piece, since you have those 4 cccc's extra in the middle or is it that the (by example) right part TGAAAGTGACTACGAGGG (from the one you created with the deletion) will be attached to the TGAAAGTGACTACGAGGG part of the original and then start the recombination, ending with the final part (the left part of the created piece of dna) AGTCTGCGATAGCAGAGT and this ending with that last T , meaning that those 4 CCCC's in the middle will not be replicated and thus be lost.
or is this a wrong view?
==> AGTCTGCGATAGCAGAGT(kanamycin)TGAAAGTGACTACGAGGG and you use this to swap the kanamycin with the 4 c's , right?
This I understand, but when you have a deletion it seems strange to me that AGTCTGCGATAGCAGAGT-TGAAAGTGACTACGAGGG will attach itself to the AGTCTGCGATAGCAGAGTCCCCTGAAAGTGACTACGAGGG dna piece, since you have those 4 cccc's extra in the middle or is it that the (by example) right part TGAAAGTGACTACGAGGG (from the one you created with the deletion) will be attached to the TGAAAGTGACTACGAGGG part of the original and then start the recombination, ending with the final part (the left part of the created piece of dna) AGTCTGCGATAGCAGAGT and this ending with that last T , meaning that those 4 CCCC's in the middle will not be replicated and thus be lost.
or is this a wrong view?
It may seem strange, but it does work. The non-complementary DNA (in this case, the 4 Cs) will form a loop when the plasmid binds complementary DNA in the genome. Well, maybe not even a loop, but the 4 Cs were an example. Many times you'll actually delete a large chunk of the DNA, not just a few bases. However, sometimes deleting or changing a few bases also gets done, although I haven't done that sort of mutation.
As for you explanation, I think that's at least partially right. The crossover events result in replication, and if the crossover occurs, those 4 Cs are not included in replication and are lost, resulting in the mutation.
-fishdoc-
Ok, I see.
thanks a lot for your help.
-lucilius-
A bit late, but you might wanne check the following article.
Its an open source article so no need to be a university student or something.
-pito-
