vivo expression technology - ivet (Jul/22/2009 )
Eum, oh well, as long as I have a better view on it, its ok.
I do have one more question, but maybe I better start a new topic about this.
Anyway: how do they create those mutated bacteria strains that have a gene deletion.
I do not see how you can simply delete a gene from a bacteria.
I have read something about the use of plasmids to do this, but how does this work?
lucilius on Jul 23 2009, 10:13 AM said:
I do have one more question, but maybe I better start a new topic about this.
Anyway: how do they create those mutated bacteria strains that have a gene deletion.
I do not see how you can simply delete a gene from a bacteria.
I have read something about the use of plasmids to do this, but how does this work?
It's very easy and done quite often.
It can be done with plasmids or bacteriophage.
The way I've done it is to either create a deletion in the sequence by PCR or restriction digest. Alternatively, you can put an antibiotic resistance marker in the middle of a gene to disrupt it. Then, the construct gets subcloned into a suicide plasmid and conjugated into the wild type bacteria. Once inside the plasmid can't replicate (hence the name "suicide vector"), and it eventually disappears unless it is integrated. Integration can occur via the gene-sequence in the plasmid recombining with the genomic DNA, and allelic exchange occurs. The mutation goes into the genome, and you select for it either on antibiotic resistance, metabolic dependency, or some other phenotype.
This is a very brief and watered down explanation of how to do it, but it covers the basics. There are numerous papers out there detailing bacterial mutagenesis, and there may be some articles in the "protocols" link at the top of this page.
This topic is large, and probably isn't suited for a message board (at least the theory or practice of bacterial mutagenesis), so you'd probably be better off finding some literature or talking to someone in person about how it's done.
I would be happy to answer specific questions about the process, but can't give a detailed explanation of the entire process.
Yeah, you are right.
The problem is that I do not have a good molecular biology background, so its hard for me to understand the scientif explenations used in the articles.
2 more questions about this: how does the dna from the plasmid get into the genome of the bacteria? Integration, ok, but what is this? How can it get in the chromosome of the bacteria?
You say that the plasmid will die if it is not integrated in the genome (since its a suicide vector), but to get integrated , does the plasmide fall apart? The wall of the plasmid must break down first to set the dna free or?
(PS. by suicide plasmid you do mean a plasmid without a Origin of replication? or not?)
lucilius on Jul 23 2009, 01:48 PM said:
The problem is that I do not have a good molecular biology background, so its hard for me to understand the scientif explenations used in the articles.
2 more questions about this: how does the dna from the plasmid get into the genome of the bacteria? Integration, ok, but what is this? How can it get in the chromosome of the bacteria?
You say that the plasmid will die if it is not integrated in the genome (since its a suicide vector), but to get integrated , does the plasmide fall apart? The wall of the plasmid must break down first to set the dna free or?
(PS. by suicide plasmid you do mean a plasmid without a Origin of replication? or not?)
The plasmid has an origin of replication that is dependent upon a certain protein. If that protein is not present, the plasmid does not replicate, and eventually gets diluted out. You propagate the plasmid in an E. coli strain that produces the needed protein (lambda pir is an example). But when it's conjugated or electroporated into the target bacterium, it doesn't replicate if that bacterium doesn't encode the protein.
The plasmid DNA enters the genome by homologous recombination. An explanation of that should be available in any bacterial genetics text, and I'd imagine there are explanations available online for that process.
Thanks again for the answer.
And about homologous recombination: I have checked it, and know it, however it is always explained with 2 ds-DNA ; = + = ==> ..)
However I am also looking into it in the case of 1 ds dna (the initial ds dna of the bacteria and the new single stranded dna you insert , because I am also interested in the insertion of naked dna , not using a plasmid)
And about this I only seem to find very basic information like: the single straned dna enters the cel and is then integrated in the original chromosome by homologous recombination.
And then I always stumble back at the part where you have 2 ds dna pieces, here you onyl have 1 , so I wonder how you get that 1 piece in or on the double stranded piece of dna.
lucilius on Jul 23 2009, 03:47 PM said:
And about homologous recombination: I have checked it, and know it, however it is always explained with 2 ds-DNA ; = + = ==> ..)
However I am also looking into it in the case of 1 ds dna (the initial ds dna of the bacteria and the new single stranded dna you insert , because I am also interested in the insertion of naked dna , not using a plasmid)
And about this I only seem to find very basic information like: the single straned dna enters the cel and is then integrated in the original chromosome by homologous recombination.
And then I always stumble back at the part where you have 2 ds dna pieces, here you onyl have 1 , so I wonder how you get that 1 piece in or on the double stranded piece of dna.
I know of homologous recombination with a linear piece of dsDNA, but have not heard of it being done with ssDNA. Basically you have a piece of dsDNA like a PCR product and you electroporate it into the bacterium and plate on the proper media to select for homologous recombination. The bacterium I work with will not take up linear dsDNA well, so we need to conjugate a plasmid.
fishdoc on Jul 24 2009, 12:05 AM said:
lucilius on Jul 23 2009, 03:47 PM said:
And about homologous recombination: I have checked it, and know it, however it is always explained with 2 ds-DNA ; = + = ==> ..)
However I am also looking into it in the case of 1 ds dna (the initial ds dna of the bacteria and the new single stranded dna you insert , because I am also interested in the insertion of naked dna , not using a plasmid)
And about this I only seem to find very basic information like: the single straned dna enters the cel and is then integrated in the original chromosome by homologous recombination.
And then I always stumble back at the part where you have 2 ds dna pieces, here you onyl have 1 , so I wonder how you get that 1 piece in or on the double stranded piece of dna.
I know of homologous recombination with a linear piece of dsDNA, but have not heard of it being done with ssDNA. Basically you have a piece of dsDNA like a PCR product and you electroporate it into the bacterium and plate on the proper media to select for homologous recombination. The bacterium I work with will not take up linear dsDNA well, so we need to conjugate a plasmid.
Yeah, well thats my question too: I know about 2 ds pieces, then homologous recombination, but what when you have 1 ds dna (the chromosome) and 1 single stranded piece of dna!
(I even found a flash animation about it: 1single stranded + 1 ds dna
And by conjugate, you do mean the proces of bacterial conjugation?
You mean you need to insert the plasmid in a bacterium that does have the ability to uptake the plasmid and then you use this bacterium, that is capable to conjugate with the other one, to get the plasmid in the second bacterium?
lucilius on Jul 24 2009, 09:22 AM said:
fishdoc on Jul 24 2009, 12:05 AM said:
lucilius on Jul 23 2009, 03:47 PM said:
And about homologous recombination: I have checked it, and know it, however it is always explained with 2 ds-DNA ; = + = ==> ..)
However I am also looking into it in the case of 1 ds dna (the initial ds dna of the bacteria and the new single stranded dna you insert , because I am also interested in the insertion of naked dna , not using a plasmid)
And about this I only seem to find very basic information like: the single straned dna enters the cel and is then integrated in the original chromosome by homologous recombination.
And then I always stumble back at the part where you have 2 ds dna pieces, here you onyl have 1 , so I wonder how you get that 1 piece in or on the double stranded piece of dna.
I know of homologous recombination with a linear piece of dsDNA, but have not heard of it being done with ssDNA. Basically you have a piece of dsDNA like a PCR product and you electroporate it into the bacterium and plate on the proper media to select for homologous recombination. The bacterium I work with will not take up linear dsDNA well, so we need to conjugate a plasmid.
Yeah, well thats my question too: I know about 2 ds pieces, then homologous recombination, but what when you have 1 ds dna (the chromosome) and 1 single stranded piece of dna!
(I even found a flash animation about it: 1single stranded + 1 ds dna
And by conjugate, you do mean the proces of bacterial conjugation?
You mean you need to insert the plasmid in a bacterium that does have the ability to uptake the plasmid and then you use this bacterium, that is capable to conjugate with the other one, to get the plasmid in the second bacterium?
OK, I see. To be able to do that, your bacterium must be able to take up environmental DNA. They talk about it in the video about the DNA binding a receptor and nucleases degrading one strand. In that instance, you're still adding dsDNA, but the action of the bacterium makes it ssDNA. I'm not sure that you can add ssDNA and get the same result, but maybe. I'm not that familiar with bacteria that are naturally competent for environmental DNA uptake.
Yes, I mean bacterial conjugation. My bacterium doesn't take kindly to electroporated DNA (linear or circular), but accepts plasmids by conjugation pretty well.
For what you're talking about, it all depends on what species of bacteria you're working with and what capabilities is has for taking up environmental DNA.
As for your last question, yes, that's what we do. We clone into plasmids carried by E. coli, then transfer the plasmids (by electroporation) to a conjugation strain of E. coli (usually SM10 lambda pir, but sometimes S17 1 lamda pir), and mate that with our bacteria, and the plasmid gets transferred by bacterial conjugation. Once the plasmid is in the target strain, it does not replicate without the lambda pir protein, and either recombines or gets lost by dilution when the bacteria replicate.
There are two possibilities for homologous recombination. A single-crossover event will result in the entire plasmid integrating into the genome. A double-crossover will result in just a piece of the plasmid integrating, which is how the mutation gets transferred.
fishdoc on Jul 24 2009, 05:41 PM said:
lucilius on Jul 24 2009, 09:22 AM said:
fishdoc on Jul 24 2009, 12:05 AM said:
lucilius on Jul 23 2009, 03:47 PM said:
And about homologous recombination: I have checked it, and know it, however it is always explained with 2 ds-DNA ; = + = ==> ..)
However I am also looking into it in the case of 1 ds dna (the initial ds dna of the bacteria and the new single stranded dna you insert , because I am also interested in the insertion of naked dna , not using a plasmid)
And about this I only seem to find very basic information like: the single straned dna enters the cel and is then integrated in the original chromosome by homologous recombination.
And then I always stumble back at the part where you have 2 ds dna pieces, here you onyl have 1 , so I wonder how you get that 1 piece in or on the double stranded piece of dna.
I know of homologous recombination with a linear piece of dsDNA, but have not heard of it being done with ssDNA. Basically you have a piece of dsDNA like a PCR product and you electroporate it into the bacterium and plate on the proper media to select for homologous recombination. The bacterium I work with will not take up linear dsDNA well, so we need to conjugate a plasmid.
Yeah, well thats my question too: I know about 2 ds pieces, then homologous recombination, but what when you have 1 ds dna (the chromosome) and 1 single stranded piece of dna!
(I even found a flash animation about it: 1single stranded + 1 ds dna
And by conjugate, you do mean the proces of bacterial conjugation?
You mean you need to insert the plasmid in a bacterium that does have the ability to uptake the plasmid and then you use this bacterium, that is capable to conjugate with the other one, to get the plasmid in the second bacterium?
OK, I see. To be able to do that, your bacterium must be able to take up environmental DNA. They talk about it in the video about the DNA binding a receptor and nucleases degrading one strand. In that instance, you're still adding dsDNA, but the action of the bacterium makes it ssDNA. I'm not sure that you can add ssDNA and get the same result, but maybe. I'm not that familiar with bacteria that are naturally competent for environmental DNA uptake.
Yes, I mean bacterial conjugation. My bacterium doesn't take kindly to electroporated DNA (linear or circular), but accepts plasmids by conjugation pretty well.
For what you're talking about, it all depends on what species of bacteria you're working with and what capabilities is has for taking up environmental DNA.
As for your last question, yes, that's what we do. We clone into plasmids carried by E. coli, then transfer the plasmids (by electroporation) to a conjugation strain of E. coli (usually SM10 lambda pir, but sometimes S17 1 lamda pir), and mate that with our bacteria, and the plasmid gets transferred by bacterial conjugation. Once the plasmid is in the target strain, it does not replicate without the lambda pir protein, and either recombines or gets lost by dilution when the bacteria replicate.
There are two possibilities for homologous recombination. A single-crossover event will result in the entire plasmid integrating into the genome. A double-crossover will result in just a piece of the plasmid integrating, which is how the mutation gets transferred.
I was indeed talking about ds dna at the start, but when it enters the bacterium it becomes ss dna and then you have homologous recombination with ds dna and ss dna...
and thats where I am getting confused since homologous recombination is always explained with 2 ds dna pieces.
I understand that the with a double crossover only a piece of the plasmid is integrated, but you state that by single crossover the entire plasmid wille be integrated in the genome, isnt it possible that a little part of the plasmids dna isnt integrated?
PS. it is with double crossover that the mutation is tranferred, but there is absolutly no way how you can direct this, so its possible that the mutation isnt transferred at all then?
You do not know wich piece is tranferred....
lucilius on Jul 24 2009, 11:21 AM said:
and thats where I am getting confused since homologous recombination is always explained with 2 ds dna pieces.
I understand that the with a double crossover only a piece of the plasmid is integrated, but you state that by single crossover the entire plasmid wille be integrated in the genome, isnt it possible that a little part of the plasmids dna isnt integrated?
PS. it is with double crossover that the mutation is tranferred, but there is absolutly no way how you can direct this, so its possible that the mutation isnt transferred at all then?
You do not know wich piece is tranferred....
I'm not familiar with how ssDNA recombines with dsDNA. I'm sure there are enzymes involved, but I can't explain the mechanism. It may be similar to, or the same as when dsDNA recombines. I don't know.
For your second question, for a single crossover event, the whole plasmid integrates. At least that's how I've always known it to occur. I don't see how a piece of the plasmid wouldn't integrate during a single crossover event.
For you last question, there is most definitely a way to direct homologous recombination... by using homologous sequences.
For a short example, say your gene sequence is:
AGTCTGCGATAGCAGAGTCCCCTGAAAGTGACTACGAGGG
and you want to remove the string of 4 Cs in the middle. You make a construct that is AGTCTGCGATAGCAGAGT-TGAAAGTGACTACGAGGG (where the (-) is the deletion). That sequence flanking the deletion will direct where recombination occurs. Recombination will only occur in areas where there is homologous DNA present.
However, if you're talking about transposons, phage, or other types of DNA, they can insert into non-homologous regions, but for the scope of what we're talking about here, the sequence flanking the mutation will direct where the recombination occurs.
For us, we need at least 500 bp on either side of a mutation for efficient recombination to occur. Sometimes up to 1 kb is needed. However, there are strains of E. coli (I think) and Salmonella (for sure) that have a lambda red phage that allows for recombination to occur with as few as 40 bp or so of flanking sequence.
Again, I don't know how all this translates to ssDNA recombining, but this is basically how it works for dsDNA, either linear or in a plasmid, recombining with genomic.
