Changing the vector - (Aug/05/2014 )

After ligation you have to transform to your competent cells and plate them to selective plates to kill of those without plasmid. Then you generally culture a few of the colonies on your plate in liquid medium, do a miniprep to extract the plasmid (keep some of the culture to make a frozen glycerol stock if the clone turns out to be good) and cut with a restriction enzyme that will give different patterns with and without the gene of interest. Send the clones that look correct for sequencing.

Hi there, The ligation step did not work:

I have few question regarding this;

1- after digesting both PCR fragment and Vector who to purify is PCR cleaning kit is enough?

2- I read about dephosphorylation of the vector before  ligation is it necessary?

how to perform this step. 

Any tips are highly appreciated.

After digesting, a PCR cleanup kit is fine for your PCR fragment but you will want to run some on a gel to make sure you have a single, clean band. For your vector, you may need to run it on a gel and extract the band for the vector. I use the Gel Extraction/PCR Cleanup kit from Promega but there are other alternative kits.

Dephosphorylation of the vector is used if there is a chance the digested vector will ligate to itself. This happens if the two restriction sites you used have ends that can anneal (say if you use two blunt cutting enzymes or if you just cut with one enzyme) If this isn't the case there's no need :-)

If you have a single clean band in your PCR, and have trouble with the ligation step, it can help to do a subcloning step into a TOPO vector as TOPO reactions are pretty high efficiency. Invitrogen sells those and you'd want a kit compatible with the type of polymerase you are using. Most high fidelity polymerases leave blunt ends so you use the TOPO blunt kits. If you used Taq our another polymerase that leaves an A overhang, use the TA TOPO kits. With the size and sequence of your fragment, hopefully you are using high fidelity ;-)

Thank you for sufficient answers as always. I use HF plymerase but the Tm of my primers are quite high ( 92 and 85). For this I use 1% DEMSO as recommended. I get a band after the PCR reaction that I purify with PCR clean then gel extraction kits. when I measure the nanodrop profile I find the 160/230 ratio as low as 0.02 and concentration is low too comparing to the amount of PCR reaction I set 50ulX 8tubes. 

That's awfully high of a tm! Is that just for the part of the primers complementary to your GOI or for everything including restriction sites? When calculating the tm, you go just with the complementary sequence. Perhaps you can coy and paste in your primer sequences and I can take a look.

Hi Bio-lad these primers for everything . I need to clone the whole gene in another vector. 
Fwd_Primer: gggggg GATATC cggggagcagcg ATGCGACCCTC    
Rev Primer:  gggggg CATATG  TCATGCTCCAATAAATTCACTGCTTTGTGG   

could it be the %GC content? should I use the GC buffer instead of HF buffer?

So, does this mean you have only 14 bases of homology between your forward primer and your template? This is almost certainly inadequate.

Do you get a 4 kb band when running a gel after your PCR? Your Tm should be calculated only on the parts of your primer that bind the template. It is certainly not as high as you suggest.

You should not use a GGGGGG sequence as your junk DNA. Poly G sequences such as this are very difficult to synthesize, and you are asking for problems. Use something with a near 50% GC content.

Phage,
The sequence that is complementary is more than 14bp. In the forward primer, the lowercases right before the ATG is part of the gene itself as well. I had lowercased them to indicate where the GOI's endogenous Kozak sequence was. She's somewhat restricted in the GC content as she needs the whole gene starting with the Kozak and going the stop.

RNA,
The tm should be much lower than what you have listed. When I posted these suggested primer sequences I included a rough estimate of the tm with each (69 and 62, I believe). You don't take the added restriction sites added into consideration when calculation the annealing temp (at least not for the initial cycles). This could explain the low yield in your reactions. I would lower the tm to what I had listed in the previous post (about 60 to 65) and increase it only if you are having problems with nonspecific bands.

I have used the recommended annealing temp for Phusion HF '72 degree. Do you mean lower than that? HF buffer is suitable in this case ( that what I used before) of course I will not use DEMSO.

I would have started lower but that's just based on the tm I got using a different program than the NEB site.  If you are having trouble getting a large enough amount of the fragment, I'd try lower (60-65).  I assume your extension time is adequate for the length of the gene?