Changing the vector - (Aug/05/2014 )

thanks you Bip-Lab! Can you advice me what is the minimum sequence overlap between the primers and the gene that need to amplify

Standard primers of 20-25 bases will work fine for the coding sequence. The size of the things you add don't matter for the amplification, only the part that is specific, so only base Tm calculations off the specific part of your primers.

Note that if you are trying to get the whole coding sequence for expression, you don't have much option as to where to place the primers (from the ATG and stop codons respectively), its just a matter of adding or subtracting a base or two to get the Tm about the same for each.

thank you! yes exactly I am trying to get the whole coding sequence. it is it 4Kb. then later I will legate it to 3.4 vector!

Ok in that case the specific part of your primers with start with ATG for the forward and for the reverse it will be the reverse complement of the stop codon.

Note that if you are trying to tag the gene then you need to make sure that the tag is in-frame with the insert.

Thank you bob1 and everyone respond to mu questions. Actually I will not tag the gene. I have more one more questions do I need to linearise the the vector before cloning? 

Also if anybody can refer me to an useful site to get idea how to make point mutation starting from GOI in a vector. I am bio-physicist and really new to those things. 

You will definitely need to linearize the vector at the same (or compatible) sites that you are using in your PCR-amplified product.  If you don't, you won't be able to ligate the fragment in.  If you need more detailed help, perhaps you can post (or PM) the sequence you wish to clone and the vector in which you wish to put it.  As for making point mutations, there are several ways to go about it including the kits below:

https://www.neb.com/products/e0554-q5-site-directed-mutagenesis-kit

http://www.lifetechnologies.com/us/en/home/life-science/cloning/mutagenesis.html

http://www.thermoscientificbio.com/mutagenesis/phusion-site-directed-mutagenesis-kit/

Thank You Bio-lab. I attached the GOI and I want to clone it in pTRE3G vector. If you can help me with that it will be great. My main concern is to introduce sequence that fit to the MCS of the vector to the primers. I am not confident in doing this.

atgcgaccctccgggacggccggggcagcgctcctggcgctgctggctgcgctctgcccggcgagtcgggctctggaggaaaagaaagtttgccaaggcacgagtaacaagctcacgcagttgggcacttttgaagatcattttctcagcctccagaggatgttcaataactgtgaggtggtccttgggaatttggaaattacctatgtgcagaggaattatgatctttccttcttaaagaccatccaggaggtggctggttatgtcctcattgccctcaacacagtggagcgaattcctttggaaaacctgcagatcatcagaggaaatatgtactacgaaaattcctatgccttagcagtcttatctaactatgatgcaaataaaaccggactgaaggagctgcccatgagaaatttacaggaaatcctgcatggcgccgtgcggttcagcaacaaccctgccctgtgcaacgtggagagcatccagtggcgggacatagtcagcagtgactttctcagcaacatgtcgatggacttccagaaccacctgggcagctgccaaaagtgtgatccaagctgtcccaatgggagctgctggggtgcaggagaggagaactgccagaaactgaccaaaatcatctgtgcccagcagtgctccgggcgctgccgtggcaagtcccccagtgactgctgccacaaccagtgtgctgcaggctgcacaggcccccgggagagcgactgcctggtctgccgcaaattccgagacgaagccacgtgcaaggacacctgccccccactcatgctctacaaccccaccacgtaccagatggatgtgaaccccgagggcaaatacagctttggtgccacctgcgtgaagaagtgtccccgtaattatgtggtgacagatcacggctcgtgcgtccgagcctgtggggccgacagctatgagatggaggaagacggcgtccgcaagtgtaagaagtgcgaagggccttgccgcaaagtgtgtaacggaataggtattggtgaatttaaagactcactctccataaatgctacgaatattaaacacttcaaaaactgcacctccatcagtggcgatctccacatcctgccggtggcatttaggggtgactccttcacacatactcctcctctggatccacaggaactggatattctgaaaaccgtaaaggaaatcacagggtttttgctgattcaggcttggcctgaaaacaggacggacctccatgcctttgagaacctagaaatcatacgcggcaggaccaagcaacatggtcagttttctcttgcagtcgtcagcctgaacataacatccttgggattacgctccctcaaggagataagtgatggagatgtgataatttcaggaaacaaaaatttgtgctatgcaaatacaataaactggaaaaaactgtttgggacctccggtcagaaaaccaaaattataagcaacagaggtgaaaacagctgcaaggccacaggccaggtctgccatgccttgtgctcccccgagggctgctggggcccggagcccagggactgcgtctcttgccggaatgtcagccgaggcagggaatgcgtggacaagtgcaaccttctggagggtgagccaagggagtttgtggagaactctgagtgcatacagtgccacccagagtgcctgcctcaggccatgaacatcacctgcacaggacggggaccagacaactgtatccagtgtgcccactacattgacggcccccactgcgtcaagacctgcccggcaggagtcatgggagaaaacaacaccctggtctggaagtacgcagacgccggccatgtgtgccacctgtgccatccaaactgcacctacggatgcactgggccaggtccctaagatcccgtccatcgccactgggatggtgggggccctcctcttgctgctggtggtggccctggggatcggcctcttcatgcgaaggcgccacatcgttcggaagcgcacgctgcggaggctgctgcaggagagggagcttgtggagcctcttacacccagtggagaagctcccaaccaagctctcttgaggatcttgaaggaaactgaattcaaaaagatcaaagtgctgggctccggtgcgttcggcacggtgtataagggactctggatcccagaaggtgagaaagttaaaattcccgtcgctatcaaggaattaagagaagcaacatctccgaaagccaacaaggaaatcctcgatgaagcctacgtgatggccagcgtggacaacccccacgtgtgccgcctgctgggcatctgcctcacctccaccgtgcaactcatcacgcagctcatgcccttcggctgcctcctggactatgtccgggaacacaaagacaatattggctcccagtacctgctcaactggtgtgtgcagatcgcaaagggcatgaactacttggaggaccgtcgcttggtgcaccgcgacctggcagccaggaacgtactggtgaaaacaccgcagcatgtcaagatcacagattttgggctggccaaactgctgggtgcggaagagaaagaataccatgcagaaggaggcaaagtgcctatcaagtggatggcattggaatcaattttacacagaatctatacccaccagagtgatgtctggagctacggggtgaccgtttgggagttgatgacctttggatccaagccatatgacggaatccctgccagcgagatctcctccatcctggagaaaggagaacgcctccctcagccacccatatgtaccatcgatgtctacatgatcatggtcaagtgctggatgatagacgcagatagtcgcccaaagttccgtgagttgatcatcgaattctccaaaatggcccgagacccccagcgctaccttgtcattcagggggatgaaagaatgcatttgccaagtcctacagactccaacttctaccgtgccctgatggatgaagaagacatggacgacgtggtggatgccgacgagtacctcatcccacagcagggcttcttcagcagcccctccacgtcacggactcccctcctgagctctctgagtgcaaccagcaacaattccaccgtggcttgcattgatagaaatgggctgcaaagctgtcccatcaaggaagacagcttcttgcagcgatacagctcagaccccacaggcgccttgactgaggacagcatagacgacaccttcctcccagtgcctgaatacataaaccagtccgttcccaaaaggcccgctggctctgtgcagaatcctgtctatcacaatcagcctctgaaccccgcgcccagcagagacccacactaccaggacccccacagcactgcagtgggcaaccccgagtatctcaacactgtccagcccacctgtgtcaacagcacattcgacagccctgcccactgggcccagaaaggcagccaccaaattagcctggacaaccctgactaccagcaggacttctttcccaaggaagccaagccaaatggcatctttaagggctccacagctgaaaatgcagaatacctaagggtcgcgccacaaagcagtgaatttattggagcatga

Your specific forward primer will be the first 20-25 bp of the sequence you posted above. The reverse primer will be the reverse complement of the last 20-25 bp.  To the 5' end of each of these you need to add a restriction site, and 5' of that 6 bp to allow the RE to bind.

So your forward primer might look like this for incorporation of a BglII site (bp 7-12):

GGGCCC AGATCT atgcgaccctccgggacggc

Depending on what want to do you might want to add a Shine-Delgarno sequence (for bacterial expression) or a Kozak sequence (mammalian expression) immediately before the ATG. E.g. for a Kozak if would look like this GGGCCC AGATCT GCCACCatgcgaccc...etc.  However, these aren't necessary, but can help in some circumstances.

OK this will be a little bit long-winded.  Sorry.  here goes
 
So first things first, you need to check which of the sites in the destination vector (and thus which sites you will adding to your primers) are NOT in the sequence itself.  If they are then you will be cutting your gene of interest at the same time as you digest the sites in your primer ends (which is bad).  In this case, you have the following enzymes present (see Fig. 1 graphicy thing): EagI, PstI, BamHI, ApaI, NdeI and ClaI.  Meaning that you can only use the following: NheI, EcoRV, SalI, and MluI.
 
Fig. 1

 
Step II:
Next best step is to plan ahead.  You’ll want to do a double digest (with the enzymes whose sites are put into your primers) so it helps if you see which of the available enzymes are compatible buffer-wise (NEB has an app that lets you find this or you can find it online.  If you are using another vendor, this info should be available for their products as well).   In your case, I took NheI (NEB# R3131S) and EcoRV (R3195S) because both come from NEB in the “High Fidelity” form that use the same buffer.

 
Step III:
Now you’re going to make your primers.  In this case the sequence is somewhat chosen for you since you need the whole thing.  HOWEVER, your sequence that you gave starts at the ATG (start codon) of your GOI.  This means that your PCR fragment will lack the Kozak sequence needed to start transcription.  You want this section of your primers to be 20+bp (as Bob mentioned).  I took the first 20 because the Tm (which will be used in your PCR) is already pretty high at 68C.  Then you add a Kozak consensus sequence (italics) and the restriction site (underlined).  EcoRV will go on the forward primer and NheI on the reverse so that when you ligate, your EGFR goes into the vector in the correct orientation.  In this case, I will use the endogenous Kozac (lowercase, italics) as part of the primer.  This will be your Fwd_Primer.
               
The reverse primer, I took ~30 to as to try to match the Tm a bit at 62C.  The second has more As and Ts in that region, which is why the Tm is so low.  Remember that this is going to be the reverse strand sequence.  The gene-specific part is uppercased below.  Then you have to add the site you want to use so the NheI is on the left (uppercase and underlined).
 
On both, add a few spacer bases so the enzymes can cut efficiently.
 
Fwd_Primer: gggggg GATATC cggggagcagcg ATGCGACCCTC    Tm = 69C
Rev Primer:  gggggg CATATG  TCATGCTCCAATAAATTCACTGCTTTGTGG   Tm = 62C
 
Last step:
After you PCr and clone this, sequence, sequence, sequence!   Your sequence has a LOT of repeat elements in it which may be incorrectly copied (see Fig. 2 graphicy thing), even by high fidelity polymerases so you will want do design sequencing primers within the EGFR so that you can sequence the whole thing!
 
Fig. 2

Oh! Thank you guys really for explaining so clearly. I would never know by myself about the kozac sequences and stuff like that!