Site-directed mutagenesis - (May/13/2012 )
Alisa on Mon May 14 03:49:23 2012 said:
℃-->1 min
℃.
One of my friends said that I should use
Anyone who has better ideas please tell me!
Thank you!
Hi, would you like to upload your primers? And the primer's Tm should be calculated according to the Stratgene's manuscripts.Your insert is about 3kb and your vector is about~7.3kb so why you calculated results is 12kb? If this, you should follow the 3Kb+7.3Kb=10.3Kb and could used the 10min 20seconds for you annealing time. If prolong the annealing time, I think this may affect the Pfu's high fidelity.
What's more, you should make your Tm check, and you could have a gradient Tm PCR to see which Tm is Ok and the best choice is you'd better to rise your Tm to enhence the specificity and the mispairing, I had a case that I used a low Tm to perform my PCR but the mutant is sometimes wrong clone for the primer's binding problems. So the Tm is important to make a sense to your mutagenesis.
Moreover, I want to know whether you have make a control, no primer PCR group and treatment same as your experimental group, If you done this, you may exclude the factor---Dpn I treatment. I usually use this for my trials, this is really important for convincing your results,after all identifying clones must be sequenced.
I have done many mutant, including 1-3 amino acids, deletion,replacement, etc. All use the 18cycles could work efficiently. The average mutagenesis efficiency reach almost 60%(Pick up 3 clones may gain at least 1 mutated clone)
I never purchase this high price strategene mutagenesis kit and just purchase the KOD-plus polymerase and Dpn I. The competent cells used is self-made. And the clones usually grow >100clones. I used this PCR reaction system to perform my mutagenesis: 20-40ng template for 50ul reaction volume(for my trials, I have lowered the reaction volume to 25 ul) and the primer usually~ 1ul sometimes followed the stratgene's manuscripts it may calculated up to 1.1-1.3ul for 50 ul reaction vol.
And 10ul to run the 1% or less concentration AGE for detection your PCR products usually it may never see band in your reaction system without primer. So usually, I could detect the amplification products in my PCR and followed the next Dpn I treatment( Just pipeting up 10-20ul pcr products and add 15-20U Dpn I for treating 1hr in water bath) and then used 1-2 ul transformed into 100ul E.coli JM109. and adding 800-900ul for further culture 45min-60min and spreadering on selective plate with 200ul cultures.
Sometimes the clones may be less but I still gained the clones and sometimes I gained more than 500 clones and randomly pick up 3 clones for sequencing could be enough gained at least correct clones! The clones usually is mutated or un-mutaed without mistakes. Maybe it is so luck for my trials, but I think it won't ony by fortune.
-Jason_LuYZ-
Jason_LuYZ on Thu May 17 11:43:57 2012 said:
Alisa on Mon May 14 03:49:23 2012 said:
℃-->1 min
℃.
One of my friends said that I should use
Anyone who has better ideas please tell me!
Thank you!
Hi, would you like to upload your primers? And the primer's Tm should be calculated according to the Stratgene's manuscripts.Your insert is about 3kb and your vector is about~7.3kb so why you calculated results is 12kb? If this, you should follow the 3Kb+7.3Kb=10.3Kb and could used the 10min 20seconds for you annealing time. If prolong the annealing time, I think this may affect the Pfu's high fidelity.
What's more, you should make your Tm check, and you could have a gradient Tm PCR to see which Tm is Ok and the best choice is you'd better to rise your Tm to enhence the specificity and the mispairing, I had a case that I used a low Tm to perform my PCR but the mutant is sometimes wrong clone for the primer's binding problems. So the Tm is important to make a sense to your mutagenesis.
Moreover, I want to know whether you have make a control, no primer PCR group and treatment same as your experimental group, If you done this, you may exclude the factor---Dpn I treatment. I usually use this for my trials, this is really important for convincing your results,after all identifying clones must be sequenced.
I have done many mutant, including 1-3 amino acids, deletion,replacement, etc. All use the 18cycles could work efficiently. The average mutagenesis efficiency reach almost 60%(Pick up 3 clones may gain at least 1 mutated clone)
I never purchase this high price strategene mutagenesis kit and just purchase the KOD-plus polymerase and Dpn I. The competent cells used is self-made. And the clones usually grow >100clones. I used this PCR reaction system to perform my mutagenesis: 20-40ng template for 50ul reaction volume(for my trials, I have lowered the reaction volume to 25 ul) and the primer usually~ 1ul sometimes followed the stratgene's manuscripts it may calculated up to 1.1-1.3ul for 50 ul reaction vol.
And 10ul to run the 1% or less concentration AGE for detection your PCR products usually it may never see band in your reaction system without primer. So usually, I could detect the amplification products in my PCR and followed the next Dpn I treatment( Just pipeting up 10-20ul pcr products and add 15-20U Dpn I for treating 1hr in water bath) and then used 1-2 ul transformed into 100ul E.coli JM109. and adding 800-900ul for further culture 45min-60min and spreadering on selective plate with 200ul cultures.
Sometimes the clones may be less but I still gained the clones and sometimes I gained more than 500 clones and randomly pick up 3 clones for sequencing could be enough gained at least correct clones! The clones usually is mutated or un-mutaed without mistakes. Maybe it is so luck for my trials, but I think it won't ony by fortune.
HI
f-primer: ggatgcagaattccgacgtgactcaggatatgaag
r-primer: cttcatatcctgagtcacgtcggaattctgcatcc
this is my primer from stratgene primer design tool. But when I order primer from company, they gave me Tm just only 65
I didn't do control!
Thanks for advise!
-Alisa-
Alisa on Fri May 18 03:58:24 2012 said:
Jason_LuYZ on Thu May 17 11:43:57 2012 said:
Alisa on Mon May 14 03:49:23 2012 said:
℃-->1 min
℃.
One of my friends said that I should use
Anyone who has better ideas please tell me!
Thank you!
Hi, would you like to upload your primers? And the primer's Tm should be calculated according to the Stratgene's manuscripts.Your insert is about 3kb and your vector is about~7.3kb so why you calculated results is 12kb? If this, you should follow the 3Kb+7.3Kb=10.3Kb and could used the 10min 20seconds for you annealing time. If prolong the annealing time, I think this may affect the Pfu's high fidelity.
What's more, you should make your Tm check, and you could have a gradient Tm PCR to see which Tm is Ok and the best choice is you'd better to rise your Tm to enhence the specificity and the mispairing, I had a case that I used a low Tm to perform my PCR but the mutant is sometimes wrong clone for the primer's binding problems. So the Tm is important to make a sense to your mutagenesis.
Moreover, I want to know whether you have make a control, no primer PCR group and treatment same as your experimental group, If you done this, you may exclude the factor---Dpn I treatment. I usually use this for my trials, this is really important for convincing your results,after all identifying clones must be sequenced.
I have done many mutant, including 1-3 amino acids, deletion,replacement, etc. All use the 18cycles could work efficiently. The average mutagenesis efficiency reach almost 60%(Pick up 3 clones may gain at least 1 mutated clone)
I never purchase this high price strategene mutagenesis kit and just purchase the KOD-plus polymerase and Dpn I. The competent cells used is self-made. And the clones usually grow >100clones. I used this PCR reaction system to perform my mutagenesis: 20-40ng template for 50ul reaction volume(for my trials, I have lowered the reaction volume to 25 ul) and the primer usually~ 1ul sometimes followed the stratgene's manuscripts it may calculated up to 1.1-1.3ul for 50 ul reaction vol.
And 10ul to run the 1% or less concentration AGE for detection your PCR products usually it may never see band in your reaction system without primer. So usually, I could detect the amplification products in my PCR and followed the next Dpn I treatment( Just pipeting up 10-20ul pcr products and add 15-20U Dpn I for treating 1hr in water bath) and then used 1-2 ul transformed into 100ul E.coli JM109. and adding 800-900ul for further culture 45min-60min and spreadering on selective plate with 200ul cultures.
Sometimes the clones may be less but I still gained the clones and sometimes I gained more than 500 clones and randomly pick up 3 clones for sequencing could be enough gained at least correct clones! The clones usually is mutated or un-mutaed without mistakes. Maybe it is so luck for my trials, but I think it won't ony by fortune.
HI
f-primer: ggatgcagaattccgacgtgactcaggatatgaag
r-primer: cttcatatcctgagtcacgtcggaattctgcatcc
this is my primer from stratgene primer design tool. But when I order primer from company, they gave me Tm just only 65
I didn't do control!
Thanks for advis
Glad to see your primer and you should calculate the Tm by yourself, but not using the Tm provided by the primer-synthesis company.
Given you used Stratgene primer design tools, this may not have a severe problem, but I think the 12-17bp around both sides of your mutated is good principle.
What's more, you may give me a short sequence(often a complete sequence is more important) containning your mutaed genes or amino acids(should tell me the translate sequence and your DNA sequence), I may help you design 1-2 primers for your disgining. The primer designing programe I used is DNAstar software. A strategy for make mutagenesis may change the Codon seqence but not affecting your amino acids due to the degeneracy of codon. Sometimes I use this to reduce mispairing by influenced by the mutated nucleotide sequence.
-Jason_LuYZ-
Well, I do not know where goes wrong. But maybe, your DPnI enzyme did not work well and your template DNA (WT) are not digested completely?
I just followed the protocol. XL-blue, rather than DH5alpha, should be used after mutagenesis. You may try.
-CAT-
Jason_LuYZ on Thu May 17 11:43:57 2012 said:
Alisa on Mon May 14 03:49:23 2012 said:
℃-->1 min
℃.
One of my friends said that I should use
Anyone who has better ideas please tell me!
Thank you!
Hi, would you like to upload your primers? And the primer's Tm should be calculated according to the Stratgene's manuscripts.Your insert is about 3kb and your vector is about~7.3kb so why you calculated results is 12kb? If this, you should follow the 3Kb+7.3Kb=10.3Kb and could used the 10min 20seconds for you annealing time. If prolong the annealing time, I think this may affect the Pfu's high fidelity.
What's more, you should make your Tm check, and you could have a gradient Tm PCR to see which Tm is Ok and the best choice is you'd better to rise your Tm to enhence the specificity and the mispairing, I had a case that I used a low Tm to perform my PCR but the mutant is sometimes wrong clone for the primer's binding problems. So the Tm is important to make a sense to your mutagenesis.
Moreover, I want to know whether you have make a control, no primer PCR group and treatment same as your experimental group, If you done this, you may exclude the factor---Dpn I treatment. I usually use this for my trials, this is really important for convincing your results,after all identifying clones must be sequenced.
I have done many mutant, including 1-3 amino acids, deletion,replacement, etc. All use the 18cycles could work efficiently. The average mutagenesis efficiency reach almost 60%(Pick up 3 clones may gain at least 1 mutated clone)
I never purchase this high price strategene mutagenesis kit and just purchase the KOD-plus polymerase and Dpn I. The competent cells used is self-made. And the clones usually grow >100clones. I used this PCR reaction system to perform my mutagenesis: 20-40ng template for 50ul reaction volume(for my trials, I have lowered the reaction volume to 25 ul) and the primer usually~ 1ul sometimes followed the stratgene's manuscripts it may calculated up to 1.1-1.3ul for 50 ul reaction vol.
And 10ul to run the 1% or less concentration AGE for detection your PCR products usually it may never see band in your reaction system without primer. So usually, I could detect the amplification products in my PCR and followed the next Dpn I treatment( Just pipeting up 10-20ul pcr products and add 15-20U Dpn I for treating 1hr in water bath) and then used 1-2 ul transformed into 100ul E.coli JM109. and adding 800-900ul for further culture 45min-60min and spreadering on selective plate with 200ul cultures.
Sometimes the clones may be less but I still gained the clones and sometimes I gained more than 500 clones and randomly pick up 3 clones for sequencing could be enough gained at least correct clones! The clones usually is mutated or un-mutaed without mistakes. Maybe it is so luck for my trials, but I think it won't ony by fortune.
3. 65°C 30 sec(< 5°C less than my primers Tm-70 °C)
5. 72°C 10min
Please suggest me if something is wrong with my method
Thanks in advance!!!
-anf_zahra-
