Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account

- - - - -

problem with pcr mutagenesis

pcr mutagenesis pfu Transformation Dpn1

  • Please log in to reply
10 replies to this topic

#1 anf_zahra

anf_zahra

    member

  • Active Members
  • Pip
  • 6 posts
0
Neutral

Posted 29 July 2012 - 12:54 AM

Hey everybody,
I am working on a site-directed mutagenesis, using pfu polymerase (Promega), and dpn1(NEB)


Here is my problem: My plasmid is 3.7kb big. Until now I can't figure out what's going wrong. I can not observe any bands in my gel(except faint band of primer dimers). also tried to transform after dpn1 digestion- no colonies to be seen.. ;(


i followed the protocol http://www.methodboo...pcr/pcrmut.html


but modified the cycle conditions as follows



1. 94 °C 2 min


2. 94 °C 30 sec
3. 65°C  30 sec(< 5°C less than my primers Tm-70 °C)


4. 72°C 2min/kb plasmid (so for my plasmid 7.5min)
5. 72°C 10min
Please suggest me if something is wrong with my method
Thanks in advance!!!


_Afza_



#2 doles

doles

    member

  • Active Members
  • Pip
  • 11 posts
2
Neutral

Posted 29 July 2012 - 05:28 AM

Hi,

If I understand correctly, there is no PCR product in your reaction. You can choose from some options. First, you can change the PCR profile (for instance, you can change the annealing temperature) in order to get PCR product (mutated plasmid). In this case, you should not spend too much time getting PCR product, because the primers may not work appropriately , and you will never get a PCR product using them. Second, you can choose another mutagenesis method (I suggest this option.). There is a review about the methods: Ling, Robinson: Anal Biochem. 1997. PMID: 9417773. My favorite method was this: Datta: Nucleic Acids Res. 1995. PMID: 7501483. It may be more complicated, but it works reliably.

Good luck,

Marton

#3 anf_zahra

anf_zahra

    member

  • Active Members
  • Pip
  • 6 posts
0
Neutral

Posted 29 July 2012 - 06:15 AM

Thanks for your suggestion, I want to know whether my conditions are okay for plasmid size=3.7kb, primer size=40bp Tm= 70

°C



#4 doles

doles

    member

  • Active Members
  • Pip
  • 11 posts
2
Neutral

Posted 29 July 2012 - 06:40 AM

A protocol contains general condition for performing a task (in this case, mutagenesis), but everybody tries to use with unique vector and  primers. Therefore, a protocol works well in one particular case (with particular primers), but it does not in another case (with another primers). Your PCR (with your vector and primers) have not generated correct PCR product, so the PCR condition is not okay (not suitable for your vector and primers). Otherwise, have you tried to carry out the PCR several times?

#5 bob1

bob1

    Thelymitra pulchella

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 4,350 posts
224
Excellent

Posted 29 July 2012 - 12:22 PM

Also note that with these reactions, they aren't actually supposed to be like an ordinary PCR, they are more about copying the parental plasmid once, so you won't necessarily get bands on a gel.

I suggest you read the qickchange manual for more information.  The protocol you are following is just a very minor variant of qickchange.

#6 anf_zahra

anf_zahra

    member

  • Active Members
  • Pip
  • 6 posts
0
Neutral

Posted 29 July 2012 - 05:45 PM

View Postbob1, on 29 July 2012 - 12:22 PM, said:

Also note that with these reactions, they aren't actually supposed to be like an ordinary PCR, they are more about copying the parental plasmid once, so you won't necessarily get bands on a gel.

I suggest you read the qickchange manual for more information.  The protocol you are following is just a very minor variant of qickchange.

ya I went through it, but i don't get transformants as well.. how to check if the pcr has worked?
I am new to lab..and there are limited resources in my lab (so cant waste dpn1 or pfu ) i want to know is my conditions are OK with my template(3.7kb) and primer (Tm - 70

°C

)
or else  do you suggest to change any conditions..

#7 Trof

Trof

    Brain on a stick

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 945 posts
66
Excellent

Posted 30 July 2012 - 03:04 AM

You use 12 cycles as mentioned in the protocol, that may be not enough to see on a gel, so you can't be completely sure that transformation failed due to lack of product. You can test if your primers really work in these conditions (or you can optimise them) by increasing the number of cycles to say 25-30, in which case you definitely should be able to see a product. If you don't want to waste Dpn, you maybe don't need to treat it, as 10 ng of the original template may not be visible (but put 10 ng of the plasmid in same volume on the gel too, just in case, you would then compare intensities, since your product would be indistingushable from a linear form of the original plasmid). You can't use this for transformation of course, but you can test your primers and conditions without wasting more competent cells. But you need to repeat PCR with Pfu, since other cheaper enzyme could require different conditions and the optimisation would be useless.
Still, there is quite a chance that your primers simply won't work, ever.

You have to understand that no one can tell you if your PCR mutagenesis should work, you have some calculated Tm, that's itself is an estimate, then conditions don't only rely on Tm alone, but on the sequence itself. Your primers may have bad sequence, secondary structures etc. Then, primers may be OK, but the plasmid itself may contain regions that don't amplify well, there can be many reasons why it doesn't work, and many of those are not even understood yet.

To be brief.. your conditions look fine as they are, but that doesn't mean anything, but it may actually require higher Ta, or lower Ta. Or it may require primer redesign. Or completely different approach as mentioned. You have to try, with the approach I mentioned above for example. There is no other way. Sometimes mutagenesis works on first try, sometimes it's pain in the ass.

What did you use to design your mutagenesis primers? Can you post the sequences? That may shed some light on quality of your primers, but it may probably only tell you if your primers seem bad (in that case redesigning would be strongly suggested) or OK (which doesn't tell you if they actually will work).
Our country has a serious deficiency in lighthouses. I assume the main reason is that we have no sea.

I never trust anything that can't be doubted.

#8 anf_zahra

anf_zahra

    member

  • Active Members
  • Pip
  • 6 posts
0
Neutral

Posted 30 July 2012 - 07:57 AM

View PostTrof, on 30 July 2012 - 03:04 AM, said:

You use 12 cycles as mentioned in the protocol, that may be not enough to see on a gel, so you can't be completely sure that transformation failed due to lack of product. You can test if your primers really work in these conditions (or you can optimise them) by increasing the number of cycles to say 25-30, in which case you definitely should be able to see a product. If you don't want to waste Dpn, you maybe don't need to treat it, as 10 ng of the original template may not be visible (but put 10 ng of the plasmid in same volume on the gel too, just in case, you would then compare intensities, since your product would be indistingushable from a linear form of the original plasmid). You can't use this for transformation of course, but you can test your primers and conditions without wasting more competent cells. But you need to repeat PCR with Pfu, since other cheaper enzyme could require different conditions and the optimisation would be useless.
Still, there is quite a chance that your primers simply won't work, ever.

You have to understand that no one can tell you if your PCR mutagenesis should work, you have some calculated Tm, that's itself is an estimate, then conditions don't only rely on Tm alone, but on the sequence itself. Your primers may have bad sequence, secondary structures etc. Then, primers may be OK, but the plasmid itself may contain regions that don't amplify well, there can be many reasons why it doesn't work, and many of those are not even understood yet.

To be brief.. your conditions look fine as they are, but that doesn't mean anything, but it may actually require higher Ta, or lower Ta. Or it may require primer redesign. Or completely different approach as mentioned. You have to try, with the approach I mentioned above for example. There is no other way. Sometimes mutagenesis works on first try, sometimes it's pain in the ass.

What did you use to design your mutagenesis primers? Can you post the sequences? That may shed some light on quality of your primers, but it may probably only tell you if your primers seem bad (in that case redesigning would be strongly suggested) or OK (which doesn't tell you if they actually will work).

my sequence

>sd arv1 codng
atggcatcttcagttgagcagaaatatacttgtattaattgttatcataaatcttcaagtcttttcatgaaatacagcgataacggtatacgcctaacaaattgtgggaaacctgtagatgcatatatcgaatatgacattgtcttgataataatcgatcttatgttgcaatatacgaaagcatatcggcacttgttactgaataccaacaatccctactgtcacaaattatgcattgtttttgtgctatgtgatgcgtacacaaagtggatacgacaacgtataaagtctggtagcgagaatgtttatgatttggaatggaaattttacgaatgtttattgcgaagtacgctagaaatgacatcatttatggttgttttggtgatattattattgccacatatttctacaaaacttgctgttagcaaaatactacaggcattttgcgtgggattttacggaaatgtatttgctgttttgtcagttatatggcatttacatcatcattggtcgtatagggtgctaacggaactgttcatacttatatcgcatgtacagacgcaacgagcattacacaatgtgacactaactccaaagtgttttttgttgtcttattggccgctgctatttcgcgctttattggcttcttcatag

I have to design three mutations
primer set1(Tm= 72.6 oC)- Forward: 5' CAATATACGAAAGCATATCGGCCCTTGTTACTGAATACCAACAATCC 3'
                                          Reverse: 5' GGATTGTTGGTATTCAGTAACAAGGGCCGATATGCTTTCGTATATTG 3'
primer set2(Tm= 72.5 oC)- Forward: 5' GCATATCGGCACTTGTTACTGATTACCAACAATCCCTACTGTC 3'
                                          Reverse: 5' GACAGTAGGGATTGTTGGTAATCAGTAACAAGTGCCGATATGC 3'
primer set3(Tm= 71.9 oC)- Forward: 5' CGGTATACGCCTAACAAATTCTGGGAAACCTGTAGATGC 3'
                                          Reverse: 5' GCATCTACAGGTTTCCCAGAATTTGTTAGGCGTATACCG 3'
underlined and in red  are the mutation sites
Thank you

#9 Trof

Trof

    Brain on a stick

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 945 posts
66
Excellent

Posted 30 July 2012 - 01:16 PM

So you are doing three separate mutagenesis and none of the three works? Or you want to do multiple mutagenesis?

First I try to calculate the Tm using the Quickchange formula Tm = 81.5 + 0.41(%GC) - (675/length) - % mismatch
I got values roughly 81.5, 82 and 80 for your primers. Since in their recomendation is 78 C or more, I guess that seems to be fine.

I designed primers for these three mutations in the Quickchange design application, just for comparison, if you're interested. They are similar, bit shorter, except for the third one, where the missmatch is closer to the 3' end.

1:
5'-caatatacgaaagcatatcggcCcttgttactgaataccaacaat-3'
5'-attgttggtattcagtaacaagGgccgatatgctttcgtatattg-3'


2:
5'-atcggcacttgttactgaTtaccaacaatccctactg-3'
5'-cagtagggattgttggtaAtcagtaacaagtgccgat-3'

3:
5'-gataacggtatacgcctaacaaattCtgggaaacctgta-3'
5'-tacaggtttcccaGaatttgttaggcgtataccgttatc-3'


BUT..

I examined again your protocol and the Quickchange protocol and noticed, that in both the recomended annealing is 55 C and extension on 68 C (for Pfu enzymes). I kind of missed that before.
Why did you changed that? It's possible the higher annealing and extension is the problem, especially there is a note about the extenson. Also Quickchange has 1 minute annealing instead of 30 sec, that can probably increase binding. You can read the Quickchange manual on Agilent site it for further suggestions.
Our country has a serious deficiency in lighthouses. I assume the main reason is that we have no sea.

I never trust anything that can't be doubted.

#10 Jason_LuYZ

Jason_LuYZ

    member

  • Active Members
  • Pip
  • 12 posts
2
Neutral

Posted 30 July 2012 - 09:51 PM

View Postanf_zahra, on 29 July 2012 - 12:54 AM, said:


Hey everybody,
I am working on a site-directed mutagenesis, using pfu polymerase (Promega), and dpn1(NEB)


Here is my problem: My plasmid is 3.7kb big. Until now I can't figure out what's going wrong. I can not observe any bands in my gel(except faint band of primer dimers). also tried to transform after dpn1 digestion- no colonies to be seen.. ;(


i followed the protocol http://www.methodboo...pcr/pcrmut.html


but modified the cycle conditions as follows



1. 94 °C 2 min


2. 94 °C 30 sec
3. 65°C  30 sec(< 5°C less than my primers Tm-70 °C)


4. 72°C 2min/kb plasmid (so for my plasmid 7.5min)
5. 72°C 10min
Please suggest me if something is wrong with my method
Thanks in advance!!!


_Afza_


Hi, Afza,
Glad to receive your question. I recommend you refer to the Strategen site-directed mutagenesis kit.
I think you can retrive something my answers in this forum for this mutagenesis.
Now, I give a short of suggestion to your mutagenesis:

PCR programme should be amended as:

1. 94 °C 3 min

2. 94 °C 30 sec
3. 65°C 30 sec(< 5°C less than my primers Tm-70 °C)

4. 72°C 1 min/kb plasmid (so for my plasmid 7.5min)  3min 45sec is enough for your amplification!!!
5. 72°C 10min


The Tm calculation, please follow the method provided by Strategene Strategen site-directed mutagenesis manuscript(You can download it for free)

The template is so critical for your mutagenesis, Dam+ strain amplified plasmid and reach a high purifity. For a 50 PCR reaction volume, the template is 20-50ng, please don't exceed this contents.

The primer should by synthesized and its purity reach at least PAGE.
The PCR amplification cycles I usually using is 18 cycles.

For Argarose electrophorsis, please load 10 ul PCR products for your detection. Usually you should make a control (NO your Pfu polymerase) and the following is also treat same as your experimental group.

Good luck to you!  If you want to further information, please send me a email, Luyz0219@126.com  or Yinzhong.lu@sjtu.edu.cn

#11 anf_zahra

anf_zahra

    member

  • Active Members
  • Pip
  • 6 posts
0
Neutral

Posted 31 July 2012 - 12:22 AM

Thank you everyone..
I'll tryout and post if it works Posted Image





Also tagged with one or more of these keywords: pcr, mutagenesis, pfu, Transformation, Dpn1

Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.