Protocol Online logo
Top : New Forum Archives (2009-): :

primer sequence problem - (Aug/07/2010 )

i have obtained this primer sequence from a paper

CCAAGGA(T/C)GGCAGCAGGCGCGAAA

what dies (T/C) mean?
should i order two primer and try both or what???

Thanks

-jehane-

I would order that as "CCAAGGAYGGCAGCAGGCGCGAAA". As I understand it, most primer synthesis companies will then provide you with a mixture that is ~50% "CCAAGGATGGCAGCAGGCGCGAAA" and ~50% "CCAAGGACGGCAGCAGGCGCGAAA" -- but call the company to be sure. Why do you need the degeneracy?

-HomeBrew-

HomeBrew on Sat Aug 7 22:15:37 2010 said:


I would order that as "CCAAGGAYGGCAGCAGGCGCGAAA". As I understand it, most primer synthesis companies will then provide you with a mixture that is ~50% "CCAAGGATGGCAGCAGGCGCGAAA" and ~50% "CCAAGGACGGCAGCAGGCGCGAAA" -- but call the company to be sure. Why do you need the degeneracy?


Thank u v ery much for reply.
this primer sequence appear in a published paper that we do the same PCR protocol

-jehane-