primer sequence problem (View forum version)



jehane

Posted 07 August 2010 - 12:12 PM

i have obtained this primer sequence from a paper

CCAAGGA(T/C)GGCAGCAGGCGCGAAA

what dies (T/C) mean?
should i order two primer and try both or what???

Thanks

HomeBrew

Posted 07 August 2010 - 02:15 PM

I would order that as "CCAAGGAYGGCAGCAGGCGCGAAA". As I understand it, most primer synthesis companies will then provide you with a mixture that is ~50% "CCAAGGATGGCAGCAGGCGCGAAA" and ~50% "CCAAGGACGGCAGCAGGCGCGAAA" -- but call the company to be sure. Why do you need the degeneracy?

jehane

Posted 08 August 2010 - 04:46 AM

I would order that as "CCAAGGAYGGCAGCAGGCGCGAAA". As I understand it, most primer synthesis companies will then provide you with a mixture that is ~50% "CCAAGGATGGCAGCAGGCGCGAAA" and ~50% "CCAAGGACGGCAGCAGGCGCGAAA" -- but call the company to be sure. Why do you need the degeneracy?


Thank u v ery much for reply.
this primer sequence appear in a published paper that we do the same PCR protocol