amplified proviral genome and got human sequence - totally different sequences from what i expected (Mar/30/2010 )
HomeBrew on Apr 3 2010, 10:10 PM said:
gyma on Apr 3 2010, 06:25 AM said:
We use the Platinum PCR SuperMix High Fidelity from Invitrogen. It too has 6X fidelity versus Taq alone.
There is another experiment I'd try. Prepare four PCR reactions -- one with both primers, one with just the forward primer, one with just the reverse primer, and one with neither primer added -- and cycle them all. See what banding pattern is produced in each case.
What are your PCR cycling conditions? Can you post your primer sequences?
95c, 5min;
30cycles: 95c,30s;62c,30s;72c,1min (30s/kb for the enzyme I used);
72c, 10 min.
old primer set: F:CAGCGGTTACAAAACCGACA; R: AGCAGTTCAGGAGGTGCCGA.
new primer set:F: GCTCTACTCCTCCTCGTCATATTGTT; R: AGCTCGACCTGAGAGGAGACTTACC.
I discussed this with other people. some said there might be contamination in my PCR system. but if so, why water never showed a band?
I did what homebrew had recommended in his last reply and I found only REVERSE primer could get similar band patterns, which means this primer served as both Forward and Reverse ones. later I found the primer sequence in the genomic sequence that I cloned and it indeed was both REVERSE primer sequence at each end. The reason why I didnt find that before is that this sequence is not 100% same, and before I just copied the primer sequence and then searched for homology. because of the several-base-difference, I got nothing at all. Now I learned a lesson here, even if the last base of a primer doesnt mach, it is still possible to amplify a product. only the yield wouldnot be so good.
Anyway, it turns out the primers were not good, especially the reverse one, which caused all the nonspecific bands. However, what should I do next? I redesigned a new primer set and that didnt work neither. I suspect that the proviral load might be at an undetectable level of PCR, or at least it is equally hard to amplify proviral sequence or nonspecific human genomic products. Am I right?
Thank you guys who ever helped me in this post, especially homebrew. I really appreciate your help. of course I will appreciate more if you keep helping me 
gyma on Apr 5 2010, 11:54 AM said:
I suspected one of the primers alone was going to produce your bands -- nothing else made sense.
gyma on Apr 5 2010, 11:54 AM said:
The primer itself is incorporated into the PCR product, so it must match the primer -- it IS the primer. If there are base differences between your insert sequence and your expected primer sequence, there are two possibilities -- the primers were synthesized sloppily, or the base calling in the primer region of your insert sequence is incorrect.
gyma on Apr 5 2010, 11:54 AM said:
Must you amplify the whole 2kb region in proviral genome? Is your goal to detect the presence of these proviral genomes or to clone them in their entirety? If detection is sufficient, move your reverse primer such that it pairs with your forward primer to amplify a 1.5 kb, 1.0 kb, or 500 bp piece -- I'm sure that at some point, the primer pair will be specific to your proviral genome and not amplify any spurious bands...
Thanks a lot, homebrew.
my goal is to sequence some genes in the proviral genome, so I have to amplify the genes first.
Now I am going to optimize the PCR conditions and try to get the specific product. because the conditions optimized from the cell line didnt work in carriers, so I have to use the precious sample now. seems no other choice.