Designing primers for cloning - After primer designing, how should I perform the PCR? (Oct/27/2009 )
dpo on Oct 28 2009, 01:56 PM said:
laurequillo on Oct 28 2009, 01:45 PM said:
dpo on Oct 28 2009, 01:27 PM said:
Also the number of cycles seems very low imo, unless you start from an enourmous amount of template of course ...
So I could add just 2 extra nucleotides for cuting and use 20 macthed bases. Perfect (is always good to know how I can improve the primers!)
Regarding the cycles. Do you think 7 cycles + 30 is not enough?
oops, my mistake, I just saw the first block of 7 cycles ... but why do you change the extension temp from 71 to 75 in the different blocks?
Actually I just wrote it and I did not pay attention. I would use the same temperature around 72ºC (the temperature here could be 70-75...I think it is not a critical point right?)
laurequillo on Oct 28 2009, 02:07 PM said:
Actually I just wrote it and I did not pay attention. I would use the same temperature around 72ºC (the temperature here could be 70-75...I think it is not a critical point right?)
best to check the datasheet of your enzyme, but I normally take 72, don't know if it would make such a difference, but if you can please the enzyme with its most comfortable temp, why change it
overall, I would just take the first part of your program but do this ~35 cycles:
98º 30sec
98º 10sec
55º 20sec (annealing temp depends on the sequence of your shorter primers of course)
72º 2min (Phusion enzyme needs 15-30s/kb, check with your enzyme of course)
perform this 35 cycles
72° 5min
Perfect, Thanks! I will do the pcr in both ways and I will let you know how it goes
I´ve just adjusted the primers:
Now I have 16 extra nucleotides in my sense primer (3 bases, EcorI, Kozak,ATG) plus 28 bases from my sequence. Tm 72.9, CG 53.6%
In my antisense I have 9 extra nucleotides (3 bases, HindIII) plus 31 bases from my sequence. Tm 76.7, CG 50%
Sense: 5´- AGCGAATTCCACCATGGCCTCACATGTGCAAGTTTTCTCCCCTC -3´
Antisense: 5´- CTCAAGCTTTTATATGTAAGGGTACTGGTTGACCTTGGCGGGG-3´
It's difficult to be sure what stretch constitutes your matching bases (for example, I count 34 bases after your HindIII site in your reverse primer, but you say there are 31 matching bases)...
However, I think you still have way too many, and your Tm's are too high. For example, I would do this (matching bases only):
forward primer:
GCCTCACATGTGCAAGTTTTC
21 bp, Tm 60.7 °C
reverse primer:
TATGTAAGGGTACTGGTTGACCTTG
25 bp, Tm 60.5 °C
HomeBrew on Oct 28 2009, 08:49 PM said:
However, I think you still have way too many, and your Tm's are too high.
You are right, there are 34.
So, still too long.
I will follow your advice and go down to 21-25 bases and Tm 60ºC, and I will do a standard pcr
98º 30sec
98º 10sec
55º 20sec
72º 3-4min
35 cycles
72° 10min