Designing primers for cloning - After primer designing, how should I perform the PCR? (Oct/27/2009 )

Pages: Previous 1 2

dpo on Oct 28 2009, 01:56 PM said:

laurequillo on Oct 28 2009, 01:45 PM said:

dpo on Oct 28 2009, 01:27 PM said:

why do you add that many bases to allow the enzyme to cut? for EcoRI, I normally only add one extra nucleotide and for HindIII two extra nucleotides and (so far) I haven't ran into problems that way. For the part specific to your gene of interest, I limit myself to 20-21 bp, especially if your template is a plasmid I don't expect any difficulties regarding the primers (only the length of your amplicon may prove a difficulty if you're not using a good enzyme).

Also the number of cycles seems very low imo, unless you start from an enourmous amount of template of course ...

So I could add just 2 extra nucleotides for cuting and use 20 macthed bases. Perfect (is always good to know how I can improve the primers!)

Regarding the cycles. Do you think 7 cycles + 30 is not enough?

oops, my mistake, I just saw the first block of 7 cycles ... but why do you change the extension temp from 71 to 75 in the different blocks?

Actually I just wrote it and I did not pay attention. I would use the same temperature around 72ºC (the temperature here could be 70-75...I think it is not a critical point right?)

-laurequillo-

laurequillo on Oct 28 2009, 02:07 PM said:

Actually I just wrote it and I did not pay attention. I would use the same temperature around 72ºC (the temperature here could be 70-75...I think it is not a critical point right?)

best to check the datasheet of your enzyme, but I normally take 72, don't know if it would make such a difference, but if you can please the enzyme with its most comfortable temp, why change it

overall, I would just take the first part of your program but do this ~35 cycles:

98º 30sec

98º 10sec
55º 20sec (annealing temp depends on the sequence of your shorter primers of course)
72º 2min (Phusion enzyme needs 15-30s/kb, check with your enzyme of course)
perform this 35 cycles

72° 5min

-dpo-

Perfect, Thanks! I will do the pcr in both ways and I will let you know how it goes

-laurequillo-

I´ve just adjusted the primers:
Now I have 16 extra nucleotides in my sense primer (3 bases, EcorI, Kozak,ATG) plus 28 bases from my sequence. Tm 72.9, CG 53.6%
In my antisense I have 9 extra nucleotides (3 bases, HindIII) plus 31 bases from my sequence. Tm 76.7, CG 50%

Sense: 5´- AGCGAATTCCACCATGGCCTCACATGTGCAAGTTTTCTCCCCTC -3´
Antisense: 5´- CTCAAGCTTTTATATGTAAGGGTACTGGTTGACCTTGGCGGGG-3´

-laurequillo-

It's difficult to be sure what stretch constitutes your matching bases (for example, I count 34 bases after your HindIII site in your reverse primer, but you say there are 31 matching bases)...

However, I think you still have way too many, and your Tm's are too high. For example, I would do this (matching bases only):

forward primer:
GCCTCACATGTGCAAGTTTTC
21 bp, Tm 60.7 °C

reverse primer:
TATGTAAGGGTACTGGTTGACCTTG
25 bp, Tm 60.5 °C

-HomeBrew-

HomeBrew on Oct 28 2009, 08:49 PM said:

You are right, there are 34.

So, still too long.

I will follow your advice and go down to 21-25 bases and Tm 60ºC, and I will do a standard pcr

98º 30sec

98º 10sec
55º 20sec
72º 3-4min
35 cycles

72° 10min

-laurequillo-

Pages: Previous 1 2