Designing primers for cloning - After primer designing, how should I perform the PCR? (Oct/27/2009 )
Hi everybody,
I have my protein of interest in pcDNA3 with Flag in the N terminus, and I want to create an untagged version of my protein. I designed some primers to amplify just my sequence,adding some restriction sites and introduce it in pcDNA3.
In order to do so, I added 5 bases (to allow the enzyme to cut), an EcoRI site and a kozak sequence in the Sense primer ( 17 extra bases, and 41 matched bases, 52% CG in total) and a HindIII site and 5 more bases in the Antisese oligo (11 extra bases and 43 matched bases,53% CG in total). Here my primers:
SENSE: 5´- GCAGAGCGAATTCCACCATGGCCTCACATGTGCAAGTTTTCTCCCCTCACACCCTTCAATC -3´
ANTISENSE: 5´- CCCTCAAGCTTTTATATGTAAGGGTACTGGTTGACCTTGGCGGGGCTCAGTGGG -3´
The Tm without the extra bases are about 84ºC
My protein is about 3600bp. My questions is:
Are those primers good enough to perform the pcr, and if so, how should I perform it? I was gonna do something like this:
98º 30sec
98º 10sec
55º 20sec
71º 60sec
Repeat steps 2-4 seven times
98º 10sec
75º 1min20sec
30 times
72 10 min
4ºC
Is this the best way to perform that kind of PCR??
Thanks a lot
Unless you have a very fast polymerase, I don't think the extension time for the first few cycles is long enough for a 3.6 kb insert. Apart from that, the plan seems OK to me.
swanny on Oct 28 2009, 03:41 AM said:
Perfect, then I will change the extension time to 4 min in both cases (because in the second part of the pcr I should change it as well,right?)
Thanks a lot
Have a quick look at the data sheets that came with your enzyme, and see what they recommend for extension times. No point making the reaction go for 4 hrs when you can do it in 3?
swanny on Oct 28 2009, 05:45 AM said:
you are right! the shorter the better!
Why so many matched bases? I can't isolate the matched bases (could you show us that?), but assumming something like:
SENSE: 5´- GCAGA GC GAATTC CACCATGG CCTCACATGTGCAAGTTTTCTCCCCTCACACCCTTCAATC -3´
ANTISENSE: 5´- CCCTC AAGCTT TTATATGTAAGGGTACTGGTTGACCTTGGCGGGGCTCAGTGGG -3´
Why do you need such a long stretch of annealing bases? It's just pushing your Tms way high -- can't you use a shorter stretch?
HomeBrew on Oct 28 2009, 12:47 PM said:
SENSE: 5´- GCAGA GC GAATTC CACCATGG CCTCACATGTGCAAGTTTTCTCCCCTCACACCCTTCAATC -3´
ANTISENSE: 5´- CCCTC AAGCTT TTATATGTAAGGGTACTGGTTGACCTTGGCGGGGCTCAGTGGG -3´
Why do you need such a long stretch of annealing bases? It's just pushing your Tms way high -- can't you use a shorter stretch?
The part of my primers that match the sequence are:
Sense:5´-GCCTCACATGTGCAAGTTTTCTCCCCTCACACCCTTCAATC -3´
Antisense: 5´-TATGTAAGGGTACTGGTTGACCTTGGCGGGGCTCAGTGGG-3´
I used so many bases because I had 17 and 11 "new" bases and I thought it was better that way.Maybe it is not necessary at all. I could use a shorter one, but I am not sure how short could it be without problems.
why do you add that many bases to allow the enzyme to cut? for EcoRI, I normally only add one extra nucleotide and for HindIII two extra nucleotides and (so far) I haven't ran into problems that way. For the part specific to your gene of interest, I limit myself to 20-21 bp, especially if your template is a plasmid I don't expect any difficulties regarding the primers (only the length of your amplicon may prove a difficulty if you're not using a good enzyme).
Also the number of cycles seems very low imo, unless you start from an enourmous amount of template of course ...
dpo on Oct 28 2009, 01:27 PM said:
Also the number of cycles seems very low imo, unless you start from an enourmous amount of template of course ...
So I could add just 2 extra nucleotides for cuting and use 20 macthed bases. Perfect (is always good to know how I can improve the primers!)
Regarding the cycles. Do you think 7 cycles + 30 is not enough?
laurequillo on Oct 28 2009, 01:45 PM said:
dpo on Oct 28 2009, 01:27 PM said:
Also the number of cycles seems very low imo, unless you start from an enourmous amount of template of course ...
So I could add just 2 extra nucleotides for cuting and use 20 macthed bases. Perfect (is always good to know how I can improve the primers!)
Regarding the cycles. Do you think 7 cycles + 30 is not enough?
oops, my mistake, I just saw the first block of 7 cycles ... but why do you change the extension temp from 71 to 75 in the different blocks?